Incidental Mutation 'R4569:Arfgap1'
ID341978
Institutional Source Beutler Lab
Gene Symbol Arfgap1
Ensembl Gene ENSMUSG00000027575
Gene NameADP-ribosylation factor GTPase activating protein 1
SynonymsARF1 GAP
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R4569 (G1)
Quality Score153
Status Validated
Chromosome2
Chromosomal Location180967225-180982526 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 180976373 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029092] [ENSMUST00000108859] [ENSMUST00000108860] [ENSMUST00000108861] [ENSMUST00000108862] [ENSMUST00000184394] [ENSMUST00000185115]
Predicted Effect probably benign
Transcript: ENSMUST00000029092
SMART Domains Protein: ENSMUSP00000029092
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 310 327 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 359 392 N/A INTRINSIC
low complexity region 394 401 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108859
SMART Domains Protein: ENSMUSP00000104487
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108860
SMART Domains Protein: ENSMUSP00000104488
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 288 305 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
low complexity region 337 370 N/A INTRINSIC
low complexity region 372 379 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108861
SMART Domains Protein: ENSMUSP00000104489
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108862
SMART Domains Protein: ENSMUSP00000104490
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 290 307 N/A INTRINSIC
low complexity region 314 327 N/A INTRINSIC
low complexity region 339 372 N/A INTRINSIC
low complexity region 374 381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150507
Predicted Effect probably benign
Transcript: ENSMUST00000184394
SMART Domains Protein: ENSMUSP00000138843
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 298 315 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 347 380 N/A INTRINSIC
low complexity region 382 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185115
SMART Domains Protein: ENSMUSP00000139222
Gene: ENSMUSG00000027575

DomainStartEndE-ValueType
ArfGap 7 124 2.4e-54 SMART
low complexity region 149 160 N/A INTRINSIC
PDB:2M0W|A 198 220 1e-6 PDB
low complexity region 320 337 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
low complexity region 369 402 N/A INTRINSIC
low complexity region 404 411 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase-activating protein, which associates with the Golgi apparatus and which interacts with ADP-ribosylation factor 1. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1-bound GTP and is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is required for the fusion of these vesicles with target compartments. The activity of this protein is stimulated by phosphoinosides and inhibited by phosphatidylcholine. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Arfgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Arfgap1 APN 2 180972725 missense probably benign 0.01
IGL01521:Arfgap1 APN 2 180971578 missense probably damaging 1.00
IGL02118:Arfgap1 APN 2 180980444 missense possibly damaging 0.89
R1858:Arfgap1 UTSW 2 180974088 missense probably damaging 1.00
R2060:Arfgap1 UTSW 2 180972782 missense probably benign
R2509:Arfgap1 UTSW 2 180974053 splice site probably benign
R4423:Arfgap1 UTSW 2 180981076 missense probably benign 0.00
R4424:Arfgap1 UTSW 2 180981076 missense probably benign 0.00
R4425:Arfgap1 UTSW 2 180981076 missense probably benign 0.00
R5668:Arfgap1 UTSW 2 180974119 missense possibly damaging 0.81
R5834:Arfgap1 UTSW 2 180981162 missense probably benign 0.01
R5915:Arfgap1 UTSW 2 180978422 missense possibly damaging 0.88
R6819:Arfgap1 UTSW 2 180971685 critical splice donor site probably null
R7011:Arfgap1 UTSW 2 180972142 missense probably damaging 1.00
R7017:Arfgap1 UTSW 2 180976304 splice site probably null
R7069:Arfgap1 UTSW 2 180974120 missense probably benign 0.01
R7350:Arfgap1 UTSW 2 180971076 missense possibly damaging 0.51
R8104:Arfgap1 UTSW 2 180979229 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTTGGCTGGTCACAAGAGC -3'
(R):5'- GGCACTCATCAGCTATTCACCC -3'

Sequencing Primer
(F):5'- CAAGAGCTGTGGAGGTATTGG -3'
(R):5'- TCATCAGCTATTCACCCACAAG -3'
Posted On2015-09-24