Incidental Mutation 'R4569:Gon4l'
ID341981
Institutional Source Beutler Lab
Gene Symbol Gon4l
Ensembl Gene ENSMUSG00000054199
Gene Namegon-4-like (C.elegans)
Synonyms2610100B20Rik, 1500041I23Rik
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88835231-88910103 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 88910090 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081695] [ENSMUST00000090942] [ENSMUST00000107494] [ENSMUST00000107498] [ENSMUST00000126245]
Predicted Effect probably benign
Transcript: ENSMUST00000081695
SMART Domains Protein: ENSMUSP00000080397
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083302
Predicted Effect probably benign
Transcript: ENSMUST00000090942
SMART Domains Protein: ENSMUSP00000088461
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 349 378 N/A INTRINSIC
low complexity region 433 440 N/A INTRINSIC
low complexity region 528 543 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Blast:SANT 814 866 2e-23 BLAST
low complexity region 962 976 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1419 1435 N/A INTRINSIC
low complexity region 1453 1498 N/A INTRINSIC
low complexity region 1508 1542 N/A INTRINSIC
Pfam:PAH 1654 1700 2.1e-8 PFAM
low complexity region 1801 1812 N/A INTRINSIC
coiled coil region 1920 1944 N/A INTRINSIC
low complexity region 2086 2095 N/A INTRINSIC
SANT 2154 2205 2.2e-1 SMART
low complexity region 2208 2223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107494
SMART Domains Protein: ENSMUSP00000103118
Gene: ENSMUSG00000068922

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
Pfam:Tubulin_3 153 345 5.3e-28 PFAM
Pfam:Tubulin 169 300 7.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107498
SMART Domains Protein: ENSMUSP00000103122
Gene: ENSMUSG00000054199

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 163 N/A INTRINSIC
low complexity region 240 256 N/A INTRINSIC
low complexity region 348 377 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 527 542 N/A INTRINSIC
low complexity region 683 696 N/A INTRINSIC
Blast:SANT 813 865 1e-23 BLAST
low complexity region 961 975 N/A INTRINSIC
low complexity region 1311 1329 N/A INTRINSIC
low complexity region 1418 1434 N/A INTRINSIC
low complexity region 1452 1497 N/A INTRINSIC
low complexity region 1507 1541 N/A INTRINSIC
Pfam:PAH 1652 1700 8.8e-9 PFAM
low complexity region 1800 1811 N/A INTRINSIC
coiled coil region 1919 1943 N/A INTRINSIC
low complexity region 2085 2094 N/A INTRINSIC
SANT 2153 2204 2.2e-1 SMART
low complexity region 2207 2222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126245
SMART Domains Protein: ENSMUSP00000115645
Gene: ENSMUSG00000068922

DomainStartEndE-ValueType
Pfam:Misat_Tub_SegII 6 120 2.1e-36 PFAM
Pfam:Tubulin_3 140 332 1.9e-27 PFAM
Pfam:Tubulin 151 288 8.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147828
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit arrested B cell development at the early pro-B cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Gon4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00870:Gon4l APN 3 88857185 missense probably damaging 1.00
IGL02002:Gon4l APN 3 88895336 missense possibly damaging 0.46
IGL02065:Gon4l APN 3 88857210 missense probably null 1.00
IGL02283:Gon4l APN 3 88895364 missense probably damaging 0.99
IGL02669:Gon4l APN 3 88895499 missense probably damaging 1.00
IGL03222:Gon4l APN 3 88895643 missense possibly damaging 0.56
IGL03385:Gon4l APN 3 88907543 missense probably benign 0.10
PIT4581001:Gon4l UTSW 3 88895514 missense probably damaging 1.00
R0020:Gon4l UTSW 3 88858937 missense probably damaging 1.00
R0115:Gon4l UTSW 3 88895682 missense probably damaging 1.00
R0173:Gon4l UTSW 3 88858403 missense probably damaging 1.00
R0270:Gon4l UTSW 3 88858400 missense probably damaging 1.00
R0961:Gon4l UTSW 3 88898096 splice site probably benign
R1017:Gon4l UTSW 3 88858496 missense probably benign 0.15
R1163:Gon4l UTSW 3 88892535 missense probably damaging 1.00
R1729:Gon4l UTSW 3 88903098 missense probably damaging 1.00
R1764:Gon4l UTSW 3 88892599 missense probably damaging 1.00
R1861:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R2141:Gon4l UTSW 3 88887595 missense possibly damaging 0.66
R2347:Gon4l UTSW 3 88863517 missense probably damaging 1.00
R2402:Gon4l UTSW 3 88859043 missense probably damaging 1.00
R2842:Gon4l UTSW 3 88895487 missense probably damaging 1.00
R4375:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4376:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4377:Gon4l UTSW 3 88907387 missense probably benign 0.00
R4650:Gon4l UTSW 3 88863552 missense possibly damaging 0.94
R4859:Gon4l UTSW 3 88895348 missense probably benign 0.00
R4901:Gon4l UTSW 3 88908151 missense possibly damaging 0.50
R4998:Gon4l UTSW 3 88899998 missense probably damaging 1.00
R5059:Gon4l UTSW 3 88900012 missense probably benign 0.00
R5217:Gon4l UTSW 3 88887575 missense probably damaging 1.00
R5269:Gon4l UTSW 3 88895528 missense probably benign
R5279:Gon4l UTSW 3 88887637 missense probably benign
R5283:Gon4l UTSW 3 88887590 missense probably damaging 1.00
R5386:Gon4l UTSW 3 88858496 missense probably benign 0.15
R5433:Gon4l UTSW 3 88896225 missense possibly damaging 0.93
R5583:Gon4l UTSW 3 88899971 missense probably damaging 1.00
R5695:Gon4l UTSW 3 88896216 frame shift probably null
R5921:Gon4l UTSW 3 88909947 intron probably benign
R6003:Gon4l UTSW 3 88896093 missense probably damaging 0.99
R6063:Gon4l UTSW 3 88899999 missense probably damaging 1.00
R6217:Gon4l UTSW 3 88892661 missense possibly damaging 0.62
R6273:Gon4l UTSW 3 88855849 missense probably damaging 1.00
R6280:Gon4l UTSW 3 88890888 missense probably damaging 1.00
R6790:Gon4l UTSW 3 88858998 missense probably damaging 1.00
R6829:Gon4l UTSW 3 88880106 missense possibly damaging 0.96
R6891:Gon4l UTSW 3 88858866 intron probably null
R7128:Gon4l UTSW 3 88895692 missense possibly damaging 0.94
R7315:Gon4l UTSW 3 88895179 missense probably benign 0.00
R7355:Gon4l UTSW 3 88863520 missense probably damaging 1.00
R7426:Gon4l UTSW 3 88907522 missense probably benign
R7635:Gon4l UTSW 3 88895106 missense probably benign 0.03
R7643:Gon4l UTSW 3 88902807 missense probably damaging 1.00
R7715:Gon4l UTSW 3 88908006 missense probably benign
R7773:Gon4l UTSW 3 88895795 missense probably benign 0.00
R8090:Gon4l UTSW 3 88892624 missense probably damaging 1.00
R8224:Gon4l UTSW 3 88895142 missense probably damaging 1.00
R8260:Gon4l UTSW 3 88892630 missense probably damaging 0.98
Z1177:Gon4l UTSW 3 88859036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGATGCTCTGTACTGC -3'
(R):5'- TCCTAGAGTCTTGAGGTCGGTC -3'

Sequencing Primer
(F):5'- CTCTGTACTGCTGCGGAG -3'
(R):5'- CTTGAGGTCGGTCCATATGCAC -3'
Posted On2015-09-24