Incidental Mutation 'R4569:Otog'
ID342001
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46310147 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 720 (D720G)
Ref Sequence ENSEMBL: ENSMUSP00000147899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538] [ENSMUST00000209802]
Predicted Effect probably damaging
Transcript: ENSMUST00000164538
AA Change: D2905G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: D2905G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209802
AA Change: D720G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1817 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0600:Otog UTSW 7 46251395 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
R7502:Otog UTSW 7 46298615 missense probably damaging 1.00
R7558:Otog UTSW 7 46303160 missense probably damaging 0.99
R7577:Otog UTSW 7 46287855 missense possibly damaging 0.62
R7651:Otog UTSW 7 46241761 missense probably benign 0.00
R7689:Otog UTSW 7 46252056 missense probably damaging 1.00
R7806:Otog UTSW 7 46285776 missense probably benign
RF024:Otog UTSW 7 46287669 missense probably damaging 1.00
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTTTGATGACATGCTCG -3'
(R):5'- TGGGGCCTATTCTAGTCCCTTG -3'

Sequencing Primer
(F):5'- TGATGACATGCTCGTCCCCAG -3'
(R):5'- TGGATTACACACACACACACAC -3'
Posted On2015-09-24