Incidental Mutation 'R4569:Xpo6'
ID342004
Institutional Source Beutler Lab
Gene Symbol Xpo6
Ensembl Gene ENSMUSG00000000131
Gene Nameexportin 6
Synonyms2610005L19Rik, C230091E20Rik, Ranbp20
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.750) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126101715-126200501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126128255 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 526 (L526F)
Ref Sequence ENSEMBL: ENSMUSP00000130527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009344] [ENSMUST00000166538] [ENSMUST00000168189]
Predicted Effect probably damaging
Transcript: ENSMUST00000009344
AA Change: L525F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000009344
Gene: ENSMUSG00000000131
AA Change: L525F

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.4e-29 PFAM
low complexity region 469 484 N/A INTRINSIC
low complexity region 672 684 N/A INTRINSIC
low complexity region 1022 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166538
Predicted Effect probably benign
Transcript: ENSMUST00000166540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167268
Predicted Effect probably damaging
Transcript: ENSMUST00000168189
AA Change: L526F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130527
Gene: ENSMUSG00000000131
AA Change: L526F

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.1e-25 PFAM
low complexity region 469 485 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170675
Meta Mutation Damage Score 0.2847 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Xpo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Xpo6 APN 7 126129568 missense probably benign 0.03
IGL01432:Xpo6 APN 7 126124381 missense probably benign 0.31
IGL01627:Xpo6 APN 7 126149334 missense probably damaging 1.00
IGL01878:Xpo6 APN 7 126174193 missense probably benign 0.35
IGL02185:Xpo6 APN 7 126113808 splice site probably benign
IGL02744:Xpo6 APN 7 126108448 unclassified probably benign
IGL02927:Xpo6 APN 7 126156729 missense possibly damaging 0.86
IGL03216:Xpo6 APN 7 126104813 missense probably damaging 1.00
Cerise UTSW 7 126108844 missense probably damaging 1.00
Crayola UTSW 7 126107078 missense probably damaging 0.98
pastel UTSW 7 126108619 missense probably damaging 1.00
R0845:Xpo6 UTSW 7 126129543 splice site probably benign
R1671:Xpo6 UTSW 7 126108543 missense possibly damaging 0.92
R2349:Xpo6 UTSW 7 126113703 missense probably benign 0.18
R3051:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3052:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3053:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3902:Xpo6 UTSW 7 126120409 missense probably damaging 1.00
R4011:Xpo6 UTSW 7 126140608 missense probably benign 0.13
R4231:Xpo6 UTSW 7 126174182 missense possibly damaging 0.66
R4604:Xpo6 UTSW 7 126113752 missense possibly damaging 0.52
R4736:Xpo6 UTSW 7 126140583 missense probably benign
R4919:Xpo6 UTSW 7 126152943 missense probably benign 0.01
R4953:Xpo6 UTSW 7 126169271 missense probably damaging 1.00
R5017:Xpo6 UTSW 7 126104747 missense probably benign 0.31
R5590:Xpo6 UTSW 7 126107078 missense probably damaging 0.98
R5856:Xpo6 UTSW 7 126149502 intron probably benign
R6077:Xpo6 UTSW 7 126109952 missense possibly damaging 0.67
R6156:Xpo6 UTSW 7 126108844 missense probably damaging 1.00
R6256:Xpo6 UTSW 7 126108619 missense probably damaging 1.00
R6481:Xpo6 UTSW 7 126112885 missense probably damaging 1.00
R6500:Xpo6 UTSW 7 126171090 intron probably benign
R7407:Xpo6 UTSW 7 126171052 missense probably damaging 0.99
R7480:Xpo6 UTSW 7 126102333 nonsense probably null
R7794:Xpo6 UTSW 7 126160863 missense probably damaging 0.98
X0012:Xpo6 UTSW 7 126169227 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCCCAGCTTCTTTGTAGCAAG -3'
(R):5'- TTGTTCTGGCACTATACTAGCAG -3'

Sequencing Primer
(F):5'- AGCAAGAATTTTAAAAACCTTCTGTC -3'
(R):5'- GGCACTATACTAGCAGGTCTTATCTG -3'
Posted On2015-09-24