Incidental Mutation 'R4569:Jhy'
ID342011
Institutional Source Beutler Lab
Gene Symbol Jhy
Ensembl Gene ENSMUSG00000032023
Gene Namejunctional cadherin complex regulator
Synonyms4931429I11Rik
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40894849-40964118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40911093 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 583 (I583T)
Ref Sequence ENSEMBL: ENSMUSP00000034521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034521]
Predicted Effect probably benign
Transcript: ENSMUST00000034521
AA Change: I583T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034521
Gene: ENSMUSG00000032023
AA Change: I583T

DomainStartEndE-ValueType
low complexity region 42 51 N/A INTRINSIC
low complexity region 71 85 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 383 398 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
Pfam:DUF4591 648 767 7.2e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hydrocephalus, domed cranium, ataxia, weight loss, enlarged lateral ventricle, neuodegeneration, abnormal brain ependymal motile cilium and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Jhy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Jhy APN 9 40922752 missense probably benign 0.00
IGL00784:Jhy APN 9 40922752 missense probably benign 0.00
IGL01370:Jhy APN 9 40917142 missense probably benign 0.00
IGL01433:Jhy APN 9 40917216 missense possibly damaging 0.58
IGL01618:Jhy APN 9 40960964 missense possibly damaging 0.88
IGL01981:Jhy APN 9 40895546 missense probably damaging 1.00
IGL02047:Jhy APN 9 40917180 missense probably benign 0.00
IGL02076:Jhy APN 9 40917378 nonsense probably null
IGL02093:Jhy APN 9 40944867 splice site probably null
IGL02177:Jhy APN 9 40898257 missense probably damaging 1.00
IGL02406:Jhy APN 9 40910989 missense probably damaging 1.00
IGL02548:Jhy APN 9 40917175 nonsense probably null
IGL02550:Jhy APN 9 40917170 missense probably benign 0.26
IGL02651:Jhy APN 9 40917335 missense probably damaging 1.00
IGL03080:Jhy APN 9 40944357 missense probably damaging 1.00
IGL03168:Jhy APN 9 40917552 missense possibly damaging 0.92
IGL03384:Jhy APN 9 40960932 missense probably benign 0.01
R0980:Jhy UTSW 9 40944837 missense possibly damaging 0.91
R1703:Jhy UTSW 9 40944837 missense probably damaging 1.00
R1711:Jhy UTSW 9 40911157 nonsense probably null
R1767:Jhy UTSW 9 40961148 missense probably benign 0.07
R2371:Jhy UTSW 9 40917482 missense probably benign 0.32
R2432:Jhy UTSW 9 40960886 missense probably benign 0.21
R3840:Jhy UTSW 9 40944846 missense probably benign 0.09
R3841:Jhy UTSW 9 40944846 missense probably benign 0.09
R4368:Jhy UTSW 9 40917144 missense possibly damaging 0.95
R4570:Jhy UTSW 9 40911093 missense probably benign
R4669:Jhy UTSW 9 40961153 missense probably benign 0.03
R4762:Jhy UTSW 9 40911198 missense probably benign
R4902:Jhy UTSW 9 40897525 intron probably benign
R4932:Jhy UTSW 9 40961003 missense possibly damaging 0.66
R5704:Jhy UTSW 9 40897438 missense probably damaging 0.99
R5890:Jhy UTSW 9 40922662 nonsense probably null
R6701:Jhy UTSW 9 40917591 missense probably damaging 0.99
R7110:Jhy UTSW 9 40917260 missense probably damaging 1.00
R7266:Jhy UTSW 9 40961157 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATTCACGAGCGACTTGGC -3'
(R):5'- CAGAAAGCAGTGTTATGGATTCAAG -3'

Sequencing Primer
(F):5'- CTGACAAGCATGCTTTTATCACC -3'
(R):5'- TTCCCAATGATGGCCGACTAG -3'
Posted On2015-09-24