Incidental Mutation 'R4569:Dph1'
ID 342022
Institutional Source Beutler Lab
Gene Symbol Dph1
Ensembl Gene ENSMUSG00000078789
Gene Name diphthamide biosynthesis 1
Synonyms Dph2l1, 4930488F09Rik, Ovca1
MMRRC Submission 041793-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4569 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 75068469-75081309 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 75069721 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044949] [ENSMUST00000071562] [ENSMUST00000139958]
AlphaFold Q5NCQ5
Predicted Effect probably benign
Transcript: ENSMUST00000044949
SMART Domains Protein: ENSMUSP00000042162
Gene: ENSMUSG00000078789

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 76 377 5.3e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071562
SMART Domains Protein: ENSMUSP00000071493
Gene: ENSMUSG00000038268

DomainStartEndE-ValueType
Pfam:FSH1 1 216 1.2e-57 PFAM
Pfam:Abhydrolase_2 60 225 2.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134252
Predicted Effect probably benign
Transcript: ENSMUST00000139958
SMART Domains Protein: ENSMUSP00000116537
Gene: ENSMUSG00000078789

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 62 276 1.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156489
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme involved in the biosynthesis of diphthamide, a modified histidine found only in elongation factor-2 (EEF2). Diphthamide residues in EEF2 are targeted for ADP-ribosylation by diphtheria toxin and Pseudomonas exotoxin A. Defects in this gene have been associated with both ovarian cancer and autosomal recessive intellectual disability with short stature, craniofacial, and ectodermal anomalies. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene die perinatally of respiratory distress or earlier. Numerous systems are affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,275,262 (GRCm39) T322A probably benign Het
Abhd13 C T 8: 10,038,071 (GRCm39) P223S possibly damaging Het
Adgra3 T A 5: 50,117,905 (GRCm39) L1214F probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Ankrd13a C A 5: 114,927,373 (GRCm39) P120Q probably damaging Het
Apbb1ip A G 2: 22,739,556 (GRCm39) Y277C probably damaging Het
Arfgap1 T C 2: 180,618,166 (GRCm39) probably benign Het
Arid2 T A 15: 96,290,343 (GRCm39) V1746D probably damaging Het
C1qtnf7 T A 5: 43,766,549 (GRCm39) N49K possibly damaging Het
Cacnb2 A T 2: 14,990,811 (GRCm39) D587V possibly damaging Het
Ccar2 A T 14: 70,389,359 (GRCm39) probably null Het
Cdk2ap2 T C 19: 4,147,879 (GRCm39) F49L possibly damaging Het
Cdon A T 9: 35,388,265 (GRCm39) I747F probably damaging Het
Cyp19a1 G A 9: 54,100,607 (GRCm39) P27S probably benign Het
Cyp4v3 T A 8: 45,760,029 (GRCm39) R508W probably damaging Het
Dclk1 T C 3: 55,154,831 (GRCm39) L87P probably damaging Het
Ddx41 G A 13: 55,683,834 (GRCm39) R66C possibly damaging Het
Dmxl1 T C 18: 49,985,427 (GRCm39) Y225H probably damaging Het
Dnah7a G A 1: 53,450,818 (GRCm39) P3871S probably benign Het
Dnhd1 A G 7: 105,306,373 (GRCm39) probably null Het
Egln2 A G 7: 26,859,008 (GRCm39) I382T probably damaging Het
Enpp3 A G 10: 24,652,780 (GRCm39) Y726H probably damaging Het
Fbxo32 A G 15: 58,044,873 (GRCm39) F353L probably damaging Het
Fchsd2 G A 7: 100,926,809 (GRCm39) G657D possibly damaging Het
Fer1l4 T A 2: 155,878,559 (GRCm39) E44V possibly damaging Het
Gjb2 C T 14: 57,337,762 (GRCm39) V149I probably benign Het
Glipr1l1 A G 10: 111,898,317 (GRCm39) M141V probably benign Het
Gnaq T C 19: 16,312,370 (GRCm39) S211P probably damaging Het
Gnl1 A G 17: 36,299,142 (GRCm39) R527G probably benign Het
Gns A G 10: 121,217,083 (GRCm39) Q286R probably benign Het
Gon4l T C 3: 88,817,397 (GRCm39) probably benign Het
Gpr107 T C 2: 31,097,677 (GRCm39) probably benign Het
Gprasp1 C T X: 134,703,592 (GRCm39) R1262C probably damaging Het
Gtf2ird1 A T 5: 134,439,857 (GRCm39) D124E probably damaging Het
Hbp1 T A 12: 32,000,231 (GRCm39) probably benign Het
Hrnr C T 3: 93,230,875 (GRCm39) T371I unknown Het
Ints2 A G 11: 86,147,024 (GRCm39) C41R probably damaging Het
Jhy A G 9: 40,822,389 (GRCm39) I583T probably benign Het
Jph4 G T 14: 55,352,503 (GRCm39) R77S probably damaging Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Klhl12 A T 1: 134,413,507 (GRCm39) I331F probably benign Het
Map4k4 G A 1: 40,039,698 (GRCm39) R30Q probably damaging Het
Mgst1 C A 6: 138,133,213 (GRCm39) T176K probably damaging Het
Negr1 C A 3: 156,914,013 (GRCm39) probably benign Het
Nrg1 C T 8: 32,407,802 (GRCm39) V144I probably benign Het
Ntmt2 T A 1: 163,530,586 (GRCm39) *284C probably null Het
Or1ad8 T C 11: 50,898,381 (GRCm39) I194T possibly damaging Het
Otog A G 7: 45,959,571 (GRCm39) D720G probably damaging Het
Pex11b A T 3: 96,551,330 (GRCm39) probably benign Het
Phtf2 T C 5: 20,994,593 (GRCm39) probably benign Het
Ppip5k1 C T 2: 121,174,044 (GRCm39) R359Q possibly damaging Het
Prickle2 T C 6: 92,399,323 (GRCm39) I185V probably benign Het
Prrc2a G A 17: 35,377,473 (GRCm39) P562S unknown Het
Rdx A G 9: 51,980,141 (GRCm39) I245V probably benign Het
Rem2 T C 14: 54,715,116 (GRCm39) S98P probably damaging Het
Rhob T G 12: 8,549,373 (GRCm39) D87A probably damaging Het
Ros1 T A 10: 52,040,090 (GRCm39) E300D probably damaging Het
Sbf2 A G 7: 109,948,060 (GRCm39) probably null Het
Sipa1l3 G T 7: 29,025,287 (GRCm39) P619Q probably damaging Het
Snupn A G 9: 56,885,346 (GRCm39) E217G probably benign Het
Ston2 T A 12: 91,606,496 (GRCm39) *896C probably null Het
Stradb C T 1: 59,019,117 (GRCm39) R13* probably null Het
Tbx21 G A 11: 97,005,581 (GRCm39) A128V probably benign Het
Tep1 A T 14: 51,062,197 (GRCm39) C2552S probably benign Het
Tgif1 A T 17: 71,151,912 (GRCm39) V233E possibly damaging Het
Trim31 A T 17: 37,209,633 (GRCm39) I130L probably benign Het
Trrap C T 5: 144,728,928 (GRCm39) T614I probably benign Het
Ttn C A 2: 76,766,758 (GRCm39) V3107F probably damaging Het
Txnrd2 T G 16: 18,274,956 (GRCm39) D322E probably benign Het
Unc45b T A 11: 82,827,315 (GRCm39) probably null Het
Usp43 C T 11: 67,789,788 (GRCm39) C252Y probably damaging Het
Usp43 A T 11: 67,766,178 (GRCm39) L744* probably null Het
Vmn2r71 A C 7: 85,273,402 (GRCm39) K739Q possibly damaging Het
Vps16 C T 2: 130,284,124 (GRCm39) T653M probably benign Het
Wdr83os T A 8: 85,808,495 (GRCm39) S82R probably damaging Het
Xpo6 T A 7: 125,727,427 (GRCm39) L526F probably damaging Het
Zfhx4 G A 3: 5,466,894 (GRCm39) V2351I probably benign Het
Zfp558 A T 9: 18,367,799 (GRCm39) C330S possibly damaging Het
Other mutations in Dph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Dph1 APN 11 75,071,775 (GRCm39) splice site probably benign
IGL01317:Dph1 APN 11 75,071,486 (GRCm39) missense probably benign 0.00
IGL01872:Dph1 APN 11 75,072,167 (GRCm39) missense probably damaging 1.00
IGL02036:Dph1 APN 11 75,074,991 (GRCm39) splice site probably null
IGL02386:Dph1 APN 11 75,074,428 (GRCm39) missense probably benign 0.00
IGL02658:Dph1 APN 11 75,071,461 (GRCm39) missense probably benign 0.08
IGL02985:Dph1 APN 11 75,074,419 (GRCm39) missense possibly damaging 0.67
R0610:Dph1 UTSW 11 75,076,783 (GRCm39) splice site probably benign
R1847:Dph1 UTSW 11 75,070,557 (GRCm39) missense probably damaging 0.96
R1878:Dph1 UTSW 11 75,075,053 (GRCm39) missense probably damaging 1.00
R2037:Dph1 UTSW 11 75,076,679 (GRCm39) splice site probably null
R4666:Dph1 UTSW 11 75,072,156 (GRCm39) missense probably damaging 0.98
R6033:Dph1 UTSW 11 75,082,023 (GRCm39) start gained probably benign
R6033:Dph1 UTSW 11 75,082,023 (GRCm39) start gained probably benign
R6451:Dph1 UTSW 11 75,072,143 (GRCm39) missense probably damaging 0.99
R7149:Dph1 UTSW 11 75,070,001 (GRCm39) missense probably benign 0.00
R7698:Dph1 UTSW 11 75,081,267 (GRCm39) missense probably benign 0.01
R7776:Dph1 UTSW 11 75,081,272 (GRCm39) missense probably benign
R9299:Dph1 UTSW 11 75,070,622 (GRCm39) missense possibly damaging 0.69
R9563:Dph1 UTSW 11 75,076,825 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGAGAACTGAGGTCCAGGTG -3'
(R):5'- GTTGCAGTAGAGAGACTTGAATCTATC -3'

Sequencing Primer
(F):5'- TGAGGCACACAAGCTCTG -3'
(R):5'- GAGAGACTTGAATCTATCTGCTACC -3'
Posted On 2015-09-24