Incidental Mutation 'R4569:Dph1'
ID342022
Institutional Source Beutler Lab
Gene Symbol Dph1
Ensembl Gene ENSMUSG00000078789
Gene Namediphthamide biosynthesis 1
Synonyms4930488F09Rik, Ovca1, Dph2l1
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location75177643-75191241 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 75178895 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044949] [ENSMUST00000071562] [ENSMUST00000139958]
Predicted Effect probably benign
Transcript: ENSMUST00000044949
SMART Domains Protein: ENSMUSP00000042162
Gene: ENSMUSG00000078789

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 76 377 5.3e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071562
SMART Domains Protein: ENSMUSP00000071493
Gene: ENSMUSG00000038268

DomainStartEndE-ValueType
Pfam:FSH1 1 216 1.2e-57 PFAM
Pfam:Abhydrolase_2 60 225 2.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134252
Predicted Effect probably benign
Transcript: ENSMUST00000139958
SMART Domains Protein: ENSMUSP00000116537
Gene: ENSMUSG00000078789

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 62 276 1.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156489
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme involved in the biosynthesis of diphthamide, a modified histidine found only in elongation factor-2 (EEF2). Diphthamide residues in EEF2 are targeted for ADP-ribosylation by diphtheria toxin and Pseudomonas exotoxin A. Defects in this gene have been associated with both ovarian cancer and autosomal recessive intellectual disability with short stature, craniofacial, and ectodermal anomalies. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene die perinatally of respiratory distress or earlier. Numerous systems are affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Dph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Dph1 APN 11 75180949 splice site probably benign
IGL01317:Dph1 APN 11 75180660 missense probably benign 0.00
IGL01872:Dph1 APN 11 75181341 missense probably damaging 1.00
IGL02036:Dph1 APN 11 75184165 splice site probably null
IGL02386:Dph1 APN 11 75183602 missense probably benign 0.00
IGL02658:Dph1 APN 11 75180635 missense probably benign 0.08
IGL02985:Dph1 APN 11 75183593 missense possibly damaging 0.67
R0610:Dph1 UTSW 11 75185957 splice site probably benign
R1847:Dph1 UTSW 11 75179731 missense probably damaging 0.96
R1878:Dph1 UTSW 11 75184227 missense probably damaging 1.00
R2037:Dph1 UTSW 11 75185853 splice site probably null
R4666:Dph1 UTSW 11 75181330 missense probably damaging 0.98
R6033:Dph1 UTSW 11 75191197 start gained probably benign
R6033:Dph1 UTSW 11 75191197 start gained probably benign
R6451:Dph1 UTSW 11 75181317 missense probably damaging 0.99
R7149:Dph1 UTSW 11 75179175 missense probably benign 0.00
R7698:Dph1 UTSW 11 75190441 missense probably benign 0.01
R7776:Dph1 UTSW 11 75190446 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGAACTGAGGTCCAGGTG -3'
(R):5'- GTTGCAGTAGAGAGACTTGAATCTATC -3'

Sequencing Primer
(F):5'- TGAGGCACACAAGCTCTG -3'
(R):5'- GAGAGACTTGAATCTATCTGCTACC -3'
Posted On2015-09-24