Mutagenetix > Incidental Mutations

Incidental Mutation 'R4569:Ints2'

342023

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

041793-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4569 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86256198 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 41 (C41R)

Ref Sequence

ENSEMBL: ENSMUSP00000116633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039] [ENSMUST00000132024] [ENSMUST00000136469] [ENSMUST00000139285]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018212
AA Change: C41R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: C41R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000108039
AA Change: C41R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: C41R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130614

Predicted Effect

probably damaging
Transcript: ENSMUST00000132024
AA Change: C41R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114859
Gene: ENSMUSG00000018068
AA Change: C41R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	140	1e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

probably damaging
Transcript: ENSMUST00000136469
AA Change: C41R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116633
Gene: ENSMUSG00000018068
AA Change: C41R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	98	6.5e-31	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000139285
AA Change: C41R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119084
Gene: ENSMUSG00000018068
AA Change: C41R

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	190	1.4e-69	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141756

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Meta Mutation Damage Score

0.8333

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,625,838	T322A	probably benign	Het
Abhd13	C	T	8: 9,988,071	P223S	possibly damaging	Het
Adgra3	T	A	5: 49,960,563	L1214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd13a	C	A	5: 114,789,312	P120Q	probably damaging	Het
Apbb1ip	A	G	2: 22,849,544	Y277C	probably damaging	Het
Arfgap1	T	C	2: 180,976,373		probably benign	Het
Arid2	T	A	15: 96,392,462	V1746D	probably damaging	Het
C1qtnf7	T	A	5: 43,609,207	N49K	possibly damaging	Het
Cacnb2	A	T	2: 14,986,000	D587V	possibly damaging	Het
Ccar2	A	T	14: 70,151,910		probably null	Het
Cdk2ap2	T	C	19: 4,097,879	F49L	possibly damaging	Het
Cdon	A	T	9: 35,476,969	I747F	probably damaging	Het
Cyp19a1	G	A	9: 54,193,323	P27S	probably benign	Het
Cyp4v3	T	A	8: 45,306,992	R508W	probably damaging	Het
Dclk1	T	C	3: 55,247,410	L87P	probably damaging	Het
Ddx41	G	A	13: 55,536,021	R66C	possibly damaging	Het
Dmxl1	T	C	18: 49,852,360	Y225H	probably damaging	Het
Dnah7a	G	A	1: 53,411,659	P3871S	probably benign	Het
Dnhd1	A	G	7: 105,657,166		probably null	Het
Dph1	A	T	11: 75,178,895		probably benign	Het
Egln2	A	G	7: 27,159,583	I382T	probably damaging	Het
Enpp3	A	G	10: 24,776,882	Y726H	probably damaging	Het
Fbxo32	A	G	15: 58,181,477	F353L	probably damaging	Het
Fchsd2	G	A	7: 101,277,602	G657D	possibly damaging	Het
Fer1l4	T	A	2: 156,036,639	E44V	possibly damaging	Het
Gjb2	C	T	14: 57,100,305	V149I	probably benign	Het
Glipr1l1	A	G	10: 112,062,412	M141V	probably benign	Het
Gnaq	T	C	19: 16,335,006	S211P	probably damaging	Het
Gnl1	A	G	17: 35,988,250	R527G	probably benign	Het
Gns	A	G	10: 121,381,178	Q286R	probably benign	Het
Gon4l	T	C	3: 88,910,090		probably benign	Het
Gpr107	T	C	2: 31,207,665		probably benign	Het
Gprasp1	C	T	X: 135,802,843	R1262C	probably damaging	Het
Gtf2ird1	A	T	5: 134,411,003	D124E	probably damaging	Het
Hbp1	T	A	12: 31,950,232		probably benign	Het
Hrnr	C	T	3: 93,323,568	T371I	unknown	Het
Jhy	A	G	9: 40,911,093	I583T	probably benign	Het
Jph4	G	T	14: 55,115,046	R77S	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Klhl12	A	T	1: 134,485,769	I331F	probably benign	Het
Map4k4	G	A	1: 40,000,538	R30Q	probably damaging	Het
Mettl11b	T	A	1: 163,703,017	*284C	probably null	Het
Mgst1	C	A	6: 138,156,215	T176K	probably damaging	Het
Negr1	C	A	3: 157,208,376		probably benign	Het
Nrg1	C	T	8: 31,917,774	V144I	probably benign	Het
Olfr51	T	C	11: 51,007,554	I194T	possibly damaging	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Pex11b	A	T	3: 96,644,014		probably benign	Het
Phtf2	T	C	5: 20,789,595		probably benign	Het
Ppip5k1	C	T	2: 121,343,563	R359Q	possibly damaging	Het
Prickle2	T	C	6: 92,422,342	I185V	probably benign	Het
Prrc2a	G	A	17: 35,158,497	P562S	unknown	Het
Rdx	A	G	9: 52,068,841	I245V	probably benign	Het
Rem2	T	C	14: 54,477,659	S98P	probably damaging	Het
Rhob	T	G	12: 8,499,373	D87A	probably damaging	Het
Ros1	T	A	10: 52,163,994	E300D	probably damaging	Het
Sbf2	A	G	7: 110,348,853		probably null	Het
Sipa1l3	G	T	7: 29,325,862	P619Q	probably damaging	Het
Snupn	A	G	9: 56,978,062	E217G	probably benign	Het
Ston2	T	A	12: 91,639,722	*896C	probably null	Het
Stradb	C	T	1: 58,979,958	R13*	probably null	Het
Tbx21	G	A	11: 97,114,755	A128V	probably benign	Het
Tep1	A	T	14: 50,824,740	C2552S	probably benign	Het
Tgif1	A	T	17: 70,844,917	V233E	possibly damaging	Het
Trim31	A	T	17: 36,898,741	I130L	probably benign	Het
Trrap	C	T	5: 144,792,118	T614I	probably benign	Het
Ttn	C	A	2: 76,936,414	V3107F	probably damaging	Het
Txnrd2	T	G	16: 18,456,206	D322E	probably benign	Het
Unc45b	T	A	11: 82,936,489		probably null	Het
Usp43	A	T	11: 67,875,352	L744*	probably null	Het
Usp43	C	T	11: 67,898,962	C252Y	probably damaging	Het
Vmn2r71	A	C	7: 85,624,194	K739Q	possibly damaging	Het
Vps16	C	T	2: 130,442,204	T653M	probably benign	Het
Wdr83os	T	A	8: 85,081,866	S82R	probably damaging	Het
Xpo6	T	A	7: 126,128,255	L526F	probably damaging	Het
Zfhx4	G	A	3: 5,401,834	V2351I	probably benign	Het
Zfp558	A	T	9: 18,456,503	C330S	possibly damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGAACTTTACCTAAGCTGCTG -3'
(R):5'- TGCCAATGCAAGGACCTAC -3'

Sequencing Primer
(F):5'- ACCTAAGCTGCTGTTCTTTGCTG -3'
(R):5'- TCATATATGTGGGAAGTAGATACCG -3'

Posted On

2015-09-24