Mutagenetix > Incidental Mutations

Incidental Mutation 'R4569:Tbx21'

342024

Institutional Source

Beutler Lab

Gene Symbol

Tbx21

Ensembl Gene

ENSMUSG00000001444

Gene Name

T-box 21

Synonyms

Tbet, Tblym, T-bet, TBT1

MMRRC Submission

041793-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.293) question?

Stock #

R4569 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97098071-97115331 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 97114755 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 128 (A128V)

Ref Sequence

ENSEMBL: ENSMUSP00000001484 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001484]

Predicted Effect

probably benign
Transcript: ENSMUST00000001484
AA Change: A128V

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000001484
Gene: ENSMUSG00000001444
AA Change: A128V

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
TBOX	135	330	4.82e-111	SMART
low complexity region	498	515	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119164

Meta Mutation Damage Score

0.0631

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human ortholog of mouse Tbx21/Tbet gene. Studies in mouse show that Tbx21 protein is a Th1 cell-specific transcription factor that controls the expression of the hallmark Th1 cytokine, interferon-gamma (IFNG). Expression of the human ortholog also correlates with IFNG expression in Th1 and natural killer cells, suggesting a role for this gene in initiating Th1 lineage development from naive Th precursor cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display defects in the production of NK and NK-T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,625,838	T322A	probably benign	Het
Abhd13	C	T	8: 9,988,071	P223S	possibly damaging	Het
Adgra3	T	A	5: 49,960,563	L1214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd13a	C	A	5: 114,789,312	P120Q	probably damaging	Het
Apbb1ip	A	G	2: 22,849,544	Y277C	probably damaging	Het
Arfgap1	T	C	2: 180,976,373		probably benign	Het
Arid2	T	A	15: 96,392,462	V1746D	probably damaging	Het
C1qtnf7	T	A	5: 43,609,207	N49K	possibly damaging	Het
Cacnb2	A	T	2: 14,986,000	D587V	possibly damaging	Het
Ccar2	A	T	14: 70,151,910		probably null	Het
Cdk2ap2	T	C	19: 4,097,879	F49L	possibly damaging	Het
Cdon	A	T	9: 35,476,969	I747F	probably damaging	Het
Cyp19a1	G	A	9: 54,193,323	P27S	probably benign	Het
Cyp4v3	T	A	8: 45,306,992	R508W	probably damaging	Het
Dclk1	T	C	3: 55,247,410	L87P	probably damaging	Het
Ddx41	G	A	13: 55,536,021	R66C	possibly damaging	Het
Dmxl1	T	C	18: 49,852,360	Y225H	probably damaging	Het
Dnah7a	G	A	1: 53,411,659	P3871S	probably benign	Het
Dnhd1	A	G	7: 105,657,166		probably null	Het
Dph1	A	T	11: 75,178,895		probably benign	Het
Egln2	A	G	7: 27,159,583	I382T	probably damaging	Het
Enpp3	A	G	10: 24,776,882	Y726H	probably damaging	Het
Fbxo32	A	G	15: 58,181,477	F353L	probably damaging	Het
Fchsd2	G	A	7: 101,277,602	G657D	possibly damaging	Het
Fer1l4	T	A	2: 156,036,639	E44V	possibly damaging	Het
Gjb2	C	T	14: 57,100,305	V149I	probably benign	Het
Glipr1l1	A	G	10: 112,062,412	M141V	probably benign	Het
Gnaq	T	C	19: 16,335,006	S211P	probably damaging	Het
Gnl1	A	G	17: 35,988,250	R527G	probably benign	Het
Gns	A	G	10: 121,381,178	Q286R	probably benign	Het
Gon4l	T	C	3: 88,910,090		probably benign	Het
Gpr107	T	C	2: 31,207,665		probably benign	Het
Gprasp1	C	T	X: 135,802,843	R1262C	probably damaging	Het
Gtf2ird1	A	T	5: 134,411,003	D124E	probably damaging	Het
Hbp1	T	A	12: 31,950,232		probably benign	Het
Hrnr	C	T	3: 93,323,568	T371I	unknown	Het
Ints2	A	G	11: 86,256,198	C41R	probably damaging	Het
Jhy	A	G	9: 40,911,093	I583T	probably benign	Het
Jph4	G	T	14: 55,115,046	R77S	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Klhl12	A	T	1: 134,485,769	I331F	probably benign	Het
Map4k4	G	A	1: 40,000,538	R30Q	probably damaging	Het
Mettl11b	T	A	1: 163,703,017	*284C	probably null	Het
Mgst1	C	A	6: 138,156,215	T176K	probably damaging	Het
Negr1	C	A	3: 157,208,376		probably benign	Het
Nrg1	C	T	8: 31,917,774	V144I	probably benign	Het
Olfr51	T	C	11: 51,007,554	I194T	possibly damaging	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Pex11b	A	T	3: 96,644,014		probably benign	Het
Phtf2	T	C	5: 20,789,595		probably benign	Het
Ppip5k1	C	T	2: 121,343,563	R359Q	possibly damaging	Het
Prickle2	T	C	6: 92,422,342	I185V	probably benign	Het
Prrc2a	G	A	17: 35,158,497	P562S	unknown	Het
Rdx	A	G	9: 52,068,841	I245V	probably benign	Het
Rem2	T	C	14: 54,477,659	S98P	probably damaging	Het
Rhob	T	G	12: 8,499,373	D87A	probably damaging	Het
Ros1	T	A	10: 52,163,994	E300D	probably damaging	Het
Sbf2	A	G	7: 110,348,853		probably null	Het
Sipa1l3	G	T	7: 29,325,862	P619Q	probably damaging	Het
Snupn	A	G	9: 56,978,062	E217G	probably benign	Het
Ston2	T	A	12: 91,639,722	*896C	probably null	Het
Stradb	C	T	1: 58,979,958	R13*	probably null	Het
Tep1	A	T	14: 50,824,740	C2552S	probably benign	Het
Tgif1	A	T	17: 70,844,917	V233E	possibly damaging	Het
Trim31	A	T	17: 36,898,741	I130L	probably benign	Het
Trrap	C	T	5: 144,792,118	T614I	probably benign	Het
Ttn	C	A	2: 76,936,414	V3107F	probably damaging	Het
Txnrd2	T	G	16: 18,456,206	D322E	probably benign	Het
Unc45b	T	A	11: 82,936,489		probably null	Het
Usp43	A	T	11: 67,875,352	L744*	probably null	Het
Usp43	C	T	11: 67,898,962	C252Y	probably damaging	Het
Vmn2r71	A	C	7: 85,624,194	K739Q	possibly damaging	Het
Vps16	C	T	2: 130,442,204	T653M	probably benign	Het
Wdr83os	T	A	8: 85,081,866	S82R	probably damaging	Het
Xpo6	T	A	7: 126,128,255	L526F	probably damaging	Het
Zfhx4	G	A	3: 5,401,834	V2351I	probably benign	Het
Zfp558	A	T	9: 18,456,503	C330S	possibly damaging	Het

Other mutations in Tbx21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Tbx21	APN	11	97098923	missense	probably damaging	0.97
IGL00957:Tbx21	APN	11	97099094	missense	probably benign	0.00
IGL00975:Tbx21	APN	11	97100082	missense	possibly damaging	0.54
IGL02015:Tbx21	APN	11	97098914	missense	probably benign
IGL02930:Tbx21	APN	11	97100039	missense	probably damaging	1.00
IGL03378:Tbx21	APN	11	97114741	missense	probably benign	0.01
plateau	UTSW	11	97101478	critical splice donor site	probably null
R1923:Tbx21	UTSW	11	97100037	missense	probably damaging	1.00
R4662:Tbx21	UTSW	11	97101567	missense	probably benign	0.01
R4847:Tbx21	UTSW	11	97115031	missense	probably damaging	0.99
R5049:Tbx21	UTSW	11	97114710	missense	probably benign	0.08
R5364:Tbx21	UTSW	11	97101478	critical splice donor site	probably null
R5873:Tbx21	UTSW	11	97114648	critical splice donor site	probably null
R6064:Tbx21	UTSW	11	97114911	missense	probably damaging	0.96
R6516:Tbx21	UTSW	11	97099956	missense	possibly damaging	0.54
R6786:Tbx21	UTSW	11	97115046	missense	possibly damaging	0.88
R7038:Tbx21	UTSW	11	97099771	missense	probably damaging	1.00
R7050:Tbx21	UTSW	11	97114770	missense	probably benign	0.03
R7062:Tbx21	UTSW	11	97098893	missense	probably damaging	1.00
R7181:Tbx21	UTSW	11	97099097	missense	probably benign	0.10
R8421:Tbx21	UTSW	11	97114735	missense	probably benign	0.01
R8475:Tbx21	UTSW	11	97099982	missense	possibly damaging	0.84

Predicted Primers

PCR Primer
(F):5'- AGGAAAGTCGTTGTTCCGG -3'
(R):5'- GACCAACAGCATCGTTTCTTC -3'

Sequencing Primer
(F):5'- CCGTCCTTGCTTAGTGAT -3'
(R):5'- GGGTCGCTTCCTTGGATCC -3'

Posted On

2015-09-24