Incidental Mutation 'R4569:Ddx41'
ID342028
Institutional Source Beutler Lab
Gene Symbol Ddx41
Ensembl Gene ENSMUSG00000021494
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Synonyms2900024F02Rik
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4569 (G1)
Quality Score221
Status Validated
Chromosome13
Chromosomal Location55530410-55536658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55536021 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 66 (R66C)
Ref Sequence ENSEMBL: ENSMUSP00000153348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000021957] [ENSMUST00000224765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021956
AA Change: R55C

PolyPhen 2 Score 0.808 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: R55C

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 39 56 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
DEXDc 200 411 8.56e-53 SMART
HELICc 446 527 5.99e-34 SMART
ZnF_C2HC 581 597 1.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021957
SMART Domains Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
low complexity region 161 174 N/A INTRINSIC
low complexity region 198 242 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
coiled coil region 371 404 N/A INTRINSIC
low complexity region 566 573 N/A INTRINSIC
low complexity region 622 635 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Pfam:FAM193_C 722 776 9.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224686
Predicted Effect possibly damaging
Transcript: ENSMUST00000224765
AA Change: R66C

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225783
Meta Mutation Damage Score 0.0617 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Ddx41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ddx41 APN 13 55531399 missense probably damaging 1.00
IGL00516:Ddx41 APN 13 55532467 missense probably damaging 0.96
IGL02383:Ddx41 APN 13 55532357 missense probably benign 0.04
R0081:Ddx41 UTSW 13 55535380 missense possibly damaging 0.58
R0097:Ddx41 UTSW 13 55535878 splice site probably benign
R0412:Ddx41 UTSW 13 55530608 missense probably damaging 0.99
R0597:Ddx41 UTSW 13 55533006 missense probably damaging 1.00
R0699:Ddx41 UTSW 13 55531299 splice site probably benign
R1330:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R1812:Ddx41 UTSW 13 55535954 missense probably benign 0.03
R2011:Ddx41 UTSW 13 55534093 splice site probably null
R2224:Ddx41 UTSW 13 55531401 missense probably damaging 1.00
R2310:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2311:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2355:Ddx41 UTSW 13 55534300 missense probably benign 0.03
R2983:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3032:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3764:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3773:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3916:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3926:Ddx41 UTSW 13 55531270 missense probably damaging 1.00
R4153:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4154:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4372:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4470:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4519:Ddx41 UTSW 13 55533144 missense probably damaging 1.00
R4823:Ddx41 UTSW 13 55532055 missense probably benign 0.02
R4837:Ddx41 UTSW 13 55531648 missense possibly damaging 0.95
R5443:Ddx41 UTSW 13 55535291 missense probably benign 0.00
R5642:Ddx41 UTSW 13 55535895 missense possibly damaging 0.86
R5926:Ddx41 UTSW 13 55534299 missense probably damaging 0.99
R5949:Ddx41 UTSW 13 55532061 missense probably damaging 1.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R7254:Ddx41 UTSW 13 55533956 nonsense probably null
R7640:Ddx41 UTSW 13 55534239 missense possibly damaging 0.81
R7803:Ddx41 UTSW 13 55531921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCGTGCTGAGAAAAGAAGC -3'
(R):5'- TTCTGAGGAAGACCAGGGAC -3'

Sequencing Primer
(F):5'- AGGAGCACTGCGGCCTAG -3'
(R):5'- CCAGGGACTAGTGAACCTGAGTTC -3'
Posted On2015-09-24