Mutagenetix > Incidental Mutations

Incidental Mutation 'R4569:Tep1'

342029

Institutional Source

Beutler Lab

Gene Symbol

Tep1

Ensembl Gene

ENSMUSG00000006281

Gene Name

telomerase associated protein 1

Synonyms

Tp1

MMRRC Submission

041793-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4569 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

50824059-50870560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 50824740 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 2552 (C2552S)

Ref Sequence

ENSEMBL: ENSMUSP00000006444 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006444] [ENSMUST00000036126] [ENSMUST00000227526]

Predicted Effect

probably benign
Transcript: ENSMUST00000006444
AA Change: C2552S

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: C2552S

Domain	Start	End	E-Value	Type
Pfam:TEP1_N	1	29	2.8e-20	PFAM
Pfam:TEP1_N	31	59	1.4e-20	PFAM
Pfam:TEP1_N	61	89	3.1e-20	PFAM
Pfam:TEP1_N	91	119	3e-20	PFAM
low complexity region	195	207	N/A	INTRINSIC
low complexity region	211	229	N/A	INTRINSIC
Pfam:TROVE	230	685	3.2e-136	PFAM
Pfam:DUF4062	909	1020	2.4e-22	PFAM
Pfam:NACHT	1171	1346	9.2e-38	PFAM
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1622	1641	N/A	INTRINSIC
WD40	1673	1711	2.98e-1	SMART
WD40	1714	1752	5.33e0	SMART
WD40	1755	1794	1.52e-4	SMART
WD40	1797	1835	3.27e-4	SMART
WD40	1838	1877	3.09e-1	SMART
WD40	1880	1919	2.24e-2	SMART
WD40	1925	1962	4.95e0	SMART
WD40	1968	2003	2.29e1	SMART
WD40	2008	2045	1.72e0	SMART
WD40	2058	2097	3.89e-11	SMART
WD40	2103	2142	3.93e-7	SMART
WD40	2145	2182	4.38e-5	SMART
WD40	2184	2232	1.24e0	SMART
WD40	2235	2273	1.14e-3	SMART
WD40	2275	2315	4.46e-1	SMART
Blast:WD40	2316	2353	4e-12	BLAST
WD40	2546	2583	6.79e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000036126

SMART Domains

Protein: ENSMUSP00000048877
Gene: ENSMUSG00000036023

Domain	Start	End	E-Value	Type
WGR	95	175	1.17e-35	SMART
Pfam:PARP_reg	208	338	1.4e-49	PFAM
Pfam:PARP	341	553	1.8e-76	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000226222
AA Change: C50S

Predicted Effect

probably benign
Transcript: ENSMUST00000226430

Predicted Effect

probably benign
Transcript: ENSMUST00000227526

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228562

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228672

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228872

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

99% (87/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	A	G	7: 41,625,838	T322A	probably benign	Het
Abhd13	C	T	8: 9,988,071	P223S	possibly damaging	Het
Adgra3	T	A	5: 49,960,563	L1214F	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Ankrd13a	C	A	5: 114,789,312	P120Q	probably damaging	Het
Apbb1ip	A	G	2: 22,849,544	Y277C	probably damaging	Het
Arfgap1	T	C	2: 180,976,373		probably benign	Het
Arid2	T	A	15: 96,392,462	V1746D	probably damaging	Het
C1qtnf7	T	A	5: 43,609,207	N49K	possibly damaging	Het
Cacnb2	A	T	2: 14,986,000	D587V	possibly damaging	Het
Ccar2	A	T	14: 70,151,910		probably null	Het
Cdk2ap2	T	C	19: 4,097,879	F49L	possibly damaging	Het
Cdon	A	T	9: 35,476,969	I747F	probably damaging	Het
Cyp19a1	G	A	9: 54,193,323	P27S	probably benign	Het
Cyp4v3	T	A	8: 45,306,992	R508W	probably damaging	Het
Dclk1	T	C	3: 55,247,410	L87P	probably damaging	Het
Ddx41	G	A	13: 55,536,021	R66C	possibly damaging	Het
Dmxl1	T	C	18: 49,852,360	Y225H	probably damaging	Het
Dnah7a	G	A	1: 53,411,659	P3871S	probably benign	Het
Dnhd1	A	G	7: 105,657,166		probably null	Het
Dph1	A	T	11: 75,178,895		probably benign	Het
Egln2	A	G	7: 27,159,583	I382T	probably damaging	Het
Enpp3	A	G	10: 24,776,882	Y726H	probably damaging	Het
Fbxo32	A	G	15: 58,181,477	F353L	probably damaging	Het
Fchsd2	G	A	7: 101,277,602	G657D	possibly damaging	Het
Fer1l4	T	A	2: 156,036,639	E44V	possibly damaging	Het
Gjb2	C	T	14: 57,100,305	V149I	probably benign	Het
Glipr1l1	A	G	10: 112,062,412	M141V	probably benign	Het
Gnaq	T	C	19: 16,335,006	S211P	probably damaging	Het
Gnl1	A	G	17: 35,988,250	R527G	probably benign	Het
Gns	A	G	10: 121,381,178	Q286R	probably benign	Het
Gon4l	T	C	3: 88,910,090		probably benign	Het
Gpr107	T	C	2: 31,207,665		probably benign	Het
Gprasp1	C	T	X: 135,802,843	R1262C	probably damaging	Het
Gtf2ird1	A	T	5: 134,411,003	D124E	probably damaging	Het
Hbp1	T	A	12: 31,950,232		probably benign	Het
Hrnr	C	T	3: 93,323,568	T371I	unknown	Het
Ints2	A	G	11: 86,256,198	C41R	probably damaging	Het
Jhy	A	G	9: 40,911,093	I583T	probably benign	Het
Jph4	G	T	14: 55,115,046	R77S	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Klhl12	A	T	1: 134,485,769	I331F	probably benign	Het
Map4k4	G	A	1: 40,000,538	R30Q	probably damaging	Het
Mettl11b	T	A	1: 163,703,017	*284C	probably null	Het
Mgst1	C	A	6: 138,156,215	T176K	probably damaging	Het
Negr1	C	A	3: 157,208,376		probably benign	Het
Nrg1	C	T	8: 31,917,774	V144I	probably benign	Het
Olfr51	T	C	11: 51,007,554	I194T	possibly damaging	Het
Otog	A	G	7: 46,310,147	D720G	probably damaging	Het
Pex11b	A	T	3: 96,644,014		probably benign	Het
Phtf2	T	C	5: 20,789,595		probably benign	Het
Ppip5k1	C	T	2: 121,343,563	R359Q	possibly damaging	Het
Prickle2	T	C	6: 92,422,342	I185V	probably benign	Het
Prrc2a	G	A	17: 35,158,497	P562S	unknown	Het
Rdx	A	G	9: 52,068,841	I245V	probably benign	Het
Rem2	T	C	14: 54,477,659	S98P	probably damaging	Het
Rhob	T	G	12: 8,499,373	D87A	probably damaging	Het
Ros1	T	A	10: 52,163,994	E300D	probably damaging	Het
Sbf2	A	G	7: 110,348,853		probably null	Het
Sipa1l3	G	T	7: 29,325,862	P619Q	probably damaging	Het
Snupn	A	G	9: 56,978,062	E217G	probably benign	Het
Ston2	T	A	12: 91,639,722	*896C	probably null	Het
Stradb	C	T	1: 58,979,958	R13*	probably null	Het
Tbx21	G	A	11: 97,114,755	A128V	probably benign	Het
Tgif1	A	T	17: 70,844,917	V233E	possibly damaging	Het
Trim31	A	T	17: 36,898,741	I130L	probably benign	Het
Trrap	C	T	5: 144,792,118	T614I	probably benign	Het
Ttn	C	A	2: 76,936,414	V3107F	probably damaging	Het
Txnrd2	T	G	16: 18,456,206	D322E	probably benign	Het
Unc45b	T	A	11: 82,936,489		probably null	Het
Usp43	A	T	11: 67,875,352	L744*	probably null	Het
Usp43	C	T	11: 67,898,962	C252Y	probably damaging	Het
Vmn2r71	A	C	7: 85,624,194	K739Q	possibly damaging	Het
Vps16	C	T	2: 130,442,204	T653M	probably benign	Het
Wdr83os	T	A	8: 85,081,866	S82R	probably damaging	Het
Xpo6	T	A	7: 126,128,255	L526F	probably damaging	Het
Zfhx4	G	A	3: 5,401,834	V2351I	probably benign	Het
Zfp558	A	T	9: 18,456,503	C330S	possibly damaging	Het

Other mutations in Tep1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Tep1	APN	14	50843184	missense	probably damaging	1.00
IGL00490:Tep1	APN	14	50833473	missense	probably damaging	0.97
IGL01114:Tep1	APN	14	50850639	missense	probably damaging	0.98
IGL01294:Tep1	APN	14	50829657	splice site	probably benign
IGL01902:Tep1	APN	14	50866091	splice site	probably benign
IGL01910:Tep1	APN	14	50844112	missense	probably benign	0.06
IGL01925:Tep1	APN	14	50824498	unclassified	probably benign
IGL01965:Tep1	APN	14	50863495	splice site	probably benign
IGL02071:Tep1	APN	14	50834049	missense	possibly damaging	0.93
IGL02124:Tep1	APN	14	50854124	unclassified	probably benign
IGL02189:Tep1	APN	14	50826826	missense	probably benign
IGL02252:Tep1	APN	14	50830255	missense	possibly damaging	0.93
IGL02299:Tep1	APN	14	50840671	missense	probably damaging	0.99
IGL02343:Tep1	APN	14	50829247	missense	probably damaging	0.99
IGL02423:Tep1	APN	14	50844620	missense	possibly damaging	0.53
IGL02537:Tep1	APN	14	50836113	missense	probably damaging	0.96
IGL02601:Tep1	APN	14	50833478	nonsense	probably null
IGL02941:Tep1	APN	14	50866037	missense	probably damaging	0.98
IGL02990:Tep1	APN	14	50868246	missense	possibly damaging	0.86
IGL03144:Tep1	APN	14	50844017	splice site	probably benign
IGL03209:Tep1	APN	14	50840703	splice site	probably benign
PIT4305001:Tep1	UTSW	14	50829227	missense	possibly damaging	0.90
PIT4362001:Tep1	UTSW	14	50866053	missense	probably benign	0.23
R0058:Tep1	UTSW	14	50834065	missense	possibly damaging	0.85
R0060:Tep1	UTSW	14	50866029	missense	probably damaging	1.00
R0109:Tep1	UTSW	14	50851916	splice site	probably null
R0123:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0134:Tep1	UTSW	14	50829693	missense	possibly damaging	0.84
R0148:Tep1	UTSW	14	50824789	missense	possibly damaging	0.70
R0240:Tep1	UTSW	14	50863029	splice site	probably benign
R0243:Tep1	UTSW	14	50846987	missense	probably damaging	1.00
R0373:Tep1	UTSW	14	50836768	missense	possibly damaging	0.85
R0432:Tep1	UTSW	14	50866823	small deletion	probably benign
R0464:Tep1	UTSW	14	50847684	missense	probably benign	0.00
R0566:Tep1	UTSW	14	50845414	critical splice donor site	probably null
R0691:Tep1	UTSW	14	50866844	nonsense	probably null
R0787:Tep1	UTSW	14	50829230	missense	possibly damaging	0.85
R0972:Tep1	UTSW	14	50824296	unclassified	probably benign
R1263:Tep1	UTSW	14	50845513	missense	possibly damaging	0.84
R1300:Tep1	UTSW	14	50827055	critical splice donor site	probably null
R1327:Tep1	UTSW	14	50853099	missense	probably benign	0.18
R1556:Tep1	UTSW	14	50853042	missense	probably benign	0.06
R1584:Tep1	UTSW	14	50866037	missense	probably damaging	0.98
R1607:Tep1	UTSW	14	50824563	missense	probably null	0.99
R1686:Tep1	UTSW	14	50836788	missense	probably benign	0.12
R1715:Tep1	UTSW	14	50854567	missense	possibly damaging	0.92
R1778:Tep1	UTSW	14	50829622	intron	probably benign
R1993:Tep1	UTSW	14	50824184	missense	possibly damaging	0.93
R2071:Tep1	UTSW	14	50854282	missense	probably benign	0.23
R2104:Tep1	UTSW	14	50850580	splice site	probably benign
R2118:Tep1	UTSW	14	50855572	splice site	probably null
R2119:Tep1	UTSW	14	50838986	missense	probably benign	0.13
R2208:Tep1	UTSW	14	50866864	missense	probably benign	0.01
R2241:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2243:Tep1	UTSW	14	50854210	missense	probably benign	0.01
R2311:Tep1	UTSW	14	50833567	missense	possibly damaging	0.95
R2420:Tep1	UTSW	14	50834023	missense	probably benign
R2874:Tep1	UTSW	14	50850650	missense	possibly damaging	0.71
R3084:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3086:Tep1	UTSW	14	50827054	critical splice donor site	probably null
R3621:Tep1	UTSW	14	50829020	missense	probably damaging	0.99
R3815:Tep1	UTSW	14	50868315	missense	possibly damaging	0.71
R4124:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4125:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4127:Tep1	UTSW	14	50843734	missense	possibly damaging	0.93
R4134:Tep1	UTSW	14	50844860	missense	probably benign
R4152:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4153:Tep1	UTSW	14	50837594	missense	possibly damaging	0.72
R4191:Tep1	UTSW	14	50836806	missense	probably damaging	0.96
R4248:Tep1	UTSW	14	50862894	missense	possibly damaging	0.93
R4293:Tep1	UTSW	14	50846861	missense	probably benign
R4704:Tep1	UTSW	14	50837073	missense	probably benign	0.06
R4815:Tep1	UTSW	14	50841302	missense	probably damaging	0.99
R4978:Tep1	UTSW	14	50845434	missense	possibly damaging	0.93
R4989:Tep1	UTSW	14	50839000	missense	probably benign
R5022:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5057:Tep1	UTSW	14	50828999	missense	probably benign	0.27
R5063:Tep1	UTSW	14	50850627	missense	possibly damaging	0.86
R5118:Tep1	UTSW	14	50855587	splice site	probably null
R5128:Tep1	UTSW	14	50844279	makesense	probably null
R5149:Tep1	UTSW	14	50837398	nonsense	probably null
R5171:Tep1	UTSW	14	50824802	missense	probably benign	0.01
R5201:Tep1	UTSW	14	50868110	missense	probably benign	0.01
R5260:Tep1	UTSW	14	50838631	missense	probably benign
R5339:Tep1	UTSW	14	50844574	missense	probably damaging	0.99
R5384:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5385:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5386:Tep1	UTSW	14	50868317	missense	probably damaging	0.98
R5594:Tep1	UTSW	14	50829882	missense	possibly damaging	0.86
R5639:Tep1	UTSW	14	50853605	missense	possibly damaging	0.85
R5749:Tep1	UTSW	14	50844072	missense	possibly damaging	0.59
R5756:Tep1	UTSW	14	50837379	critical splice donor site	probably null
R6013:Tep1	UTSW	14	50861048	missense	probably damaging	0.97
R6014:Tep1	UTSW	14	50847000	missense	probably benign	0.12
R6248:Tep1	UTSW	14	50830258	missense	probably damaging	0.98
R6264:Tep1	UTSW	14	50845513	missense	probably damaging	0.99
R6363:Tep1	UTSW	14	50824548	missense	probably benign	0.04
R6381:Tep1	UTSW	14	50845431	missense	probably damaging	0.99
R6462:Tep1	UTSW	14	50844379	missense	probably benign
R6942:Tep1	UTSW	14	50836737	missense	possibly damaging	0.85
R6951:Tep1	UTSW	14	50833913	critical splice donor site	probably null
R6979:Tep1	UTSW	14	50838637	missense	possibly damaging	0.93
R6999:Tep1	UTSW	14	50850705	missense	possibly damaging	0.86
R7099:Tep1	UTSW	14	50844487	splice site	probably null
R7208:Tep1	UTSW	14	50824556	critical splice acceptor site	probably null
R7232:Tep1	UTSW	14	50844332	missense	unknown
R7249:Tep1	UTSW	14	50824275	missense	possibly damaging	0.86
R7325:Tep1	UTSW	14	50866038	missense	probably damaging	0.99
R7409:Tep1	UTSW	14	50866855	missense	possibly damaging	0.67
R7499:Tep1	UTSW	14	50853590	missense	probably damaging	0.99
R7542:Tep1	UTSW	14	50862491	nonsense	probably null
R7806:Tep1	UTSW	14	50836809	missense	possibly damaging	0.85
R7825:Tep1	UTSW	14	50843887	critical splice acceptor site	probably null
R7901:Tep1	UTSW	14	50826851	missense	possibly damaging	0.88
R7961:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R7993:Tep1	UTSW	14	50830253	missense	probably benign	0.41
R8009:Tep1	UTSW	14	50824230	missense	possibly damaging	0.93
R8085:Tep1	UTSW	14	50829296	missense	probably benign	0.11
R8299:Tep1	UTSW	14	50868045	missense	probably benign	0.06
R8330:Tep1	UTSW	14	50847705	missense	possibly damaging	0.86
R8396:Tep1	UTSW	14	50837072	missense	probably benign	0.23
R8475:Tep1	UTSW	14	50841255	missense	probably damaging	1.00
RF007:Tep1	UTSW	14	50860945	missense	possibly damaging	0.92
X0024:Tep1	UTSW	14	50827119	missense	possibly damaging	0.86
X0060:Tep1	UTSW	14	50836764	missense	probably benign	0.25
Z1177:Tep1	UTSW	14	50847765	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AACATCTCTGTCCTTCGAAGC -3'
(R):5'- TTTGTGCGCCACCTCTGATG -3'

Sequencing Primer
(F):5'- GTCCTTCGAAGCTGTCACCAG -3'
(R):5'- CACCTCTGATGGGATGCTG -3'

Posted On

2015-09-24