Incidental Mutation 'R4570:Nvl'
ID342052
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Namenuclear VCP-like
Synonyms1200009I24Rik
MMRRC Submission 041794-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4570 (G1)
Quality Score191
Status Validated
Chromosome1
Chromosomal Location181087138-181144204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181144082 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 9 (V9A)
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797] [ENSMUST00000193907]
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
AA Change: V9A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516
AA Change: V9A

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193907
SMART Domains Protein: ENSMUSP00000141442
Gene: ENSMUSG00000062169

DomainStartEndE-ValueType
Pfam:Cornichon 1 70 1.9e-20 PFAM
Meta Mutation Damage Score 0.2551 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,694 D1154G probably damaging Het
Acsl5 T A 19: 55,291,774 I493N probably damaging Het
Adgrf5 T A 17: 43,445,115 S450T probably benign Het
Ak2 T C 4: 129,002,167 V79A probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arfgef2 C A 2: 166,856,538 Q643K probably damaging Het
Asap3 A G 4: 136,240,185 D605G probably damaging Het
BC067074 T A 13: 113,318,191 V257D probably damaging Het
Ccr5 C T 9: 124,124,875 Q172* probably null Het
Cpxm2 T C 7: 132,143,706 D130G probably benign Het
Cxcl12 T C 6: 117,168,672 V6A probably benign Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dpcr1 T C 17: 35,637,991 T239A possibly damaging Het
Dzip1l A T 9: 99,647,168 K317* probably null Het
Edil3 A G 13: 89,131,897 probably benign Het
Enpep A T 3: 129,281,548 I707K possibly damaging Het
Fcrlb A G 1: 170,912,620 probably null Het
Flt1 C T 5: 147,594,613 A847T probably damaging Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Gemin6 C T 17: 80,228,069 R153* probably null Het
Gldc T A 19: 30,174,439 M112L probably benign Het
Gm10267 C T 18: 44,156,425 M79I probably benign Het
Gm10803 A G 2: 93,564,252 Y123C unknown Het
Gm28040 C A 1: 133,329,381 probably benign Het
Gm8674 T A 13: 49,902,534 noncoding transcript Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Hba-a2 T C 11: 32,297,200 Y141H probably damaging Het
Hmbox1 T A 14: 64,823,662 I388F possibly damaging Het
Hs6st1 G T 1: 36,103,547 V188L possibly damaging Het
Ipmk T G 10: 71,372,739 H118Q probably benign Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Kcna2 A G 3: 107,104,795 I231V probably benign Het
Kcnh7 T C 2: 62,837,095 T367A possibly damaging Het
Kcp A T 6: 29,491,848 C197* probably null Het
Klra2 C A 6: 131,243,937 C54F probably damaging Het
Lcn9 T C 2: 25,823,579 L39P probably benign Het
Lct T C 1: 128,299,904 N1284S probably benign Het
Map6 T G 7: 99,336,556 S556A possibly damaging Het
Mdn1 C A 4: 32,741,812 T3861K probably damaging Het
Mrps12 A G 7: 28,739,963 L109P probably damaging Het
Mybphl G A 3: 108,365,031 C12Y possibly damaging Het
Nek9 T C 12: 85,320,734 K388E probably damaging Het
Obscn T C 11: 59,006,828 probably null Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pik3c3 T A 18: 30,290,550 I233N possibly damaging Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppara A G 15: 85,787,197 I100V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Scmh1 T A 4: 120,528,298 H623Q probably damaging Het
Scn9a A G 2: 66,483,558 S1939P possibly damaging Het
Slc6a13 T C 6: 121,336,142 probably null Het
Slc7a4 G A 16: 17,574,277 T431I probably benign Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Spopl T A 2: 23,537,485 K212* probably null Het
Strn T A 17: 78,677,372 T281S possibly damaging Het
Supt3 T A 17: 45,041,229 L265* probably null Het
Taf5l G A 8: 123,997,550 T510M probably damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Tarbp1 A T 8: 126,452,233 D702E probably benign Het
Tfap2c C A 2: 172,557,327 P473Q probably damaging Het
Tnc T C 4: 63,995,672 N1301S probably damaging Het
Trim33 A G 3: 103,330,165 Q179R probably damaging Het
Txnrd2 A G 16: 18,468,804 N335S probably benign Het
Uggt1 T A 1: 36,150,073 D1444V probably damaging Het
Ugt3a2 T C 15: 9,338,721 L57P probably benign Het
Vmn2r6 A T 3: 64,559,647 W144R probably benign Het
Vmn2r98 T A 17: 19,066,092 M284K probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp703 T C 8: 26,978,953 V215A probably benign Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 181105125 missense probably damaging 1.00
IGL00943:Nvl APN 1 181101634 missense possibly damaging 0.72
IGL01956:Nvl APN 1 181134944 missense probably benign 0.00
IGL02657:Nvl APN 1 181106976 missense probably damaging 1.00
nineveh UTSW 1 181136906 missense probably benign 0.00
nubia UTSW 1 181112334 missense probably benign 0.19
IGL03098:Nvl UTSW 1 181093906 missense probably benign 0.37
P0047:Nvl UTSW 1 181112302 missense probably damaging 1.00
R0003:Nvl UTSW 1 181114133 missense probably damaging 1.00
R0114:Nvl UTSW 1 181120391 missense probably benign 0.19
R0265:Nvl UTSW 1 181134830 missense probably damaging 0.96
R0928:Nvl UTSW 1 181093902 missense probably benign 0.00
R1398:Nvl UTSW 1 181097126 splice site probably benign
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1470:Nvl UTSW 1 181139262 missense probably damaging 1.00
R1529:Nvl UTSW 1 181109159 critical splice donor site probably null
R1934:Nvl UTSW 1 181099128 missense probably damaging 0.96
R2176:Nvl UTSW 1 181135074 splice site probably benign
R2351:Nvl UTSW 1 181130792 missense probably benign 0.03
R4415:Nvl UTSW 1 181105114 missense probably benign
R4720:Nvl UTSW 1 181101587 missense probably damaging 1.00
R4888:Nvl UTSW 1 181117626 missense probably damaging 1.00
R5026:Nvl UTSW 1 181105155 missense probably damaging 1.00
R5507:Nvl UTSW 1 181135036 missense probably damaging 0.98
R5785:Nvl UTSW 1 181139298 missense probably damaging 1.00
R5983:Nvl UTSW 1 181136906 missense probably benign 0.00
R6143:Nvl UTSW 1 181134995 missense probably benign 0.01
R6532:Nvl UTSW 1 181144143 splice site probably null
R6821:Nvl UTSW 1 181126970 nonsense probably null
R7062:Nvl UTSW 1 181112334 missense probably benign 0.19
R7247:Nvl UTSW 1 181112286 critical splice donor site probably null
R7358:Nvl UTSW 1 181135036 missense probably damaging 0.98
R7665:Nvl UTSW 1 181134944 missense probably benign 0.18
R7795:Nvl UTSW 1 181097157 missense probably benign 0.00
R7931:Nvl UTSW 1 181109155 splice site probably benign
R8185:Nvl UTSW 1 181144174 unclassified probably benign
R8806:Nvl UTSW 1 181095054 missense probably benign 0.01
X0067:Nvl UTSW 1 181139158 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- ACACAGTGCTTCCAAGATACG -3'
(R):5'- CTTGACAAGGAACCAGACTGG -3'

Sequencing Primer
(F):5'- CAGTGCTTCCAAGATACGAAAATAAG -3'
(R):5'- AGCGTAGTCCTCCCTACAG -3'
Posted On2015-09-24