Incidental Mutation 'R4570:Scn9a'
ID 342056
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Name sodium channel, voltage-gated, type IX, alpha
Synonyms PN1
MMRRC Submission 041794-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4570 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 66310424-66465306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66313902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1939 (S1939P)
Ref Sequence ENSEMBL: ENSMUSP00000126528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
AlphaFold Q62205
Predicted Effect probably benign
Transcript: ENSMUST00000100063
AA Change: S1930P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: S1930P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100064
AA Change: S1939P

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: S1939P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112354
AA Change: S1928P

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: S1928P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152740
Predicted Effect possibly damaging
Transcript: ENSMUST00000164384
AA Change: S1939P

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: S1939P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169900
AA Change: S1928P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: S1928P

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 79,842,528 (GRCm39) D1154G probably damaging Het
Acsl5 T A 19: 55,280,206 (GRCm39) I493N probably damaging Het
Adgrf5 T A 17: 43,756,006 (GRCm39) S450T probably benign Het
Ak2 T C 4: 128,895,960 (GRCm39) V79A probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Arfgef2 C A 2: 166,698,458 (GRCm39) Q643K probably damaging Het
Asap3 A G 4: 135,967,496 (GRCm39) D605G probably damaging Het
Ccr5 C T 9: 123,924,912 (GRCm39) Q172* probably null Het
Cpxm2 T C 7: 131,745,435 (GRCm39) D130G probably benign Het
Cspg4b T A 13: 113,454,725 (GRCm39) V257D probably damaging Het
Cxcl12 T C 6: 117,145,633 (GRCm39) V6A probably benign Het
Cyp19a1 G A 9: 54,100,607 (GRCm39) P27S probably benign Het
Dmxl1 T C 18: 49,985,427 (GRCm39) Y225H probably damaging Het
Dzip1l A T 9: 99,529,221 (GRCm39) K317* probably null Het
Edil3 A G 13: 89,280,016 (GRCm39) probably benign Het
Enpep A T 3: 129,075,197 (GRCm39) I707K possibly damaging Het
Fcrlb A G 1: 170,740,189 (GRCm39) probably null Het
Flt1 C T 5: 147,531,423 (GRCm39) A847T probably damaging Het
Fsd2 T C 7: 81,209,518 (GRCm39) D108G probably benign Het
Gemin6 C T 17: 80,535,498 (GRCm39) R153* probably null Het
Gldc T A 19: 30,151,839 (GRCm39) M112L probably benign Het
Gm10267 C T 18: 44,289,492 (GRCm39) M79I probably benign Het
Gm10803 A G 2: 93,394,597 (GRCm39) Y123C unknown Het
Gm28040 C A 1: 133,257,119 (GRCm39) probably benign Het
Gm8674 T A 13: 50,056,570 (GRCm39) noncoding transcript Het
Gprasp1 C T X: 134,703,592 (GRCm39) R1262C probably damaging Het
Hba-a2 T C 11: 32,247,200 (GRCm39) Y141H probably damaging Het
Hmbox1 T A 14: 65,061,111 (GRCm39) I388F possibly damaging Het
Hs6st1 G T 1: 36,142,628 (GRCm39) V188L possibly damaging Het
Ipmk T G 10: 71,208,569 (GRCm39) H118Q probably benign Het
Jhy A G 9: 40,822,389 (GRCm39) I583T probably benign Het
Kcna2 A G 3: 107,012,111 (GRCm39) I231V probably benign Het
Kcnh7 T C 2: 62,667,439 (GRCm39) T367A possibly damaging Het
Kcp A T 6: 29,491,847 (GRCm39) C197* probably null Het
Klra2 C A 6: 131,220,900 (GRCm39) C54F probably damaging Het
Lcn9 T C 2: 25,713,591 (GRCm39) L39P probably benign Het
Lct T C 1: 128,227,641 (GRCm39) N1284S probably benign Het
Map6 T G 7: 98,985,763 (GRCm39) S556A possibly damaging Het
Mdn1 C A 4: 32,741,812 (GRCm39) T3861K probably damaging Het
Mrps12 A G 7: 28,439,388 (GRCm39) L109P probably damaging Het
Mucl3 T C 17: 35,948,883 (GRCm39) T239A possibly damaging Het
Mybphl G A 3: 108,272,347 (GRCm39) C12Y possibly damaging Het
Nek9 T C 12: 85,367,508 (GRCm39) K388E probably damaging Het
Nvl A G 1: 180,971,647 (GRCm39) V9A probably benign Het
Obscn T C 11: 58,897,654 (GRCm39) probably null Het
Or2h2 T C 17: 37,396,471 (GRCm39) I195M probably damaging Het
Pik3c3 T A 18: 30,423,603 (GRCm39) I233N possibly damaging Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Ppara A G 15: 85,671,398 (GRCm39) I100V probably benign Het
Rem2 T C 14: 54,715,116 (GRCm39) S98P probably damaging Het
Rpl5-ps2 G T 2: 154,546,156 (GRCm39) noncoding transcript Het
Scmh1 T A 4: 120,385,495 (GRCm39) H623Q probably damaging Het
Slc6a13 T C 6: 121,313,101 (GRCm39) probably null Het
Slc7a4 G A 16: 17,392,141 (GRCm39) T431I probably benign Het
Snupn A G 9: 56,885,346 (GRCm39) E217G probably benign Het
Spopl T A 2: 23,427,497 (GRCm39) K212* probably null Het
Strn T A 17: 78,984,801 (GRCm39) T281S possibly damaging Het
Supt3 T A 17: 45,352,116 (GRCm39) L265* probably null Het
Taf5l G A 8: 124,724,289 (GRCm39) T510M probably damaging Het
Tapbp C A 17: 34,145,427 (GRCm39) D415E probably damaging Het
Tarbp1 A T 8: 127,178,972 (GRCm39) D702E probably benign Het
Tfap2c C A 2: 172,399,247 (GRCm39) P473Q probably damaging Het
Tnc T C 4: 63,913,909 (GRCm39) N1301S probably damaging Het
Trim33 A G 3: 103,237,481 (GRCm39) Q179R probably damaging Het
Txnrd2 A G 16: 18,287,554 (GRCm39) N335S probably benign Het
Uggt1 T A 1: 36,189,154 (GRCm39) D1444V probably damaging Het
Ugt3a1 T C 15: 9,338,807 (GRCm39) L57P probably benign Het
Vmn2r6 A T 3: 64,467,068 (GRCm39) W144R probably benign Het
Vmn2r98 T A 17: 19,286,354 (GRCm39) M284K probably benign Het
Zfp558 A T 9: 18,367,799 (GRCm39) C330S possibly damaging Het
Zfp703 T C 8: 27,468,981 (GRCm39) V215A probably benign Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66,393,945 (GRCm39) missense probably damaging 1.00
IGL00570:Scn9a APN 2 66,314,486 (GRCm39) missense probably damaging 1.00
IGL00809:Scn9a APN 2 66,314,279 (GRCm39) missense probably damaging 1.00
IGL00977:Scn9a APN 2 66,314,645 (GRCm39) missense probably damaging 0.99
IGL01120:Scn9a APN 2 66,357,316 (GRCm39) missense probably benign 0.00
IGL01134:Scn9a APN 2 66,335,312 (GRCm39) missense probably damaging 1.00
IGL01300:Scn9a APN 2 66,318,397 (GRCm39) nonsense probably null
IGL01452:Scn9a APN 2 66,357,416 (GRCm39) missense probably damaging 1.00
IGL01531:Scn9a APN 2 66,367,722 (GRCm39) missense probably benign 0.11
IGL01572:Scn9a APN 2 66,324,230 (GRCm39) missense probably benign 0.00
IGL01645:Scn9a APN 2 66,317,986 (GRCm39) missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66,314,386 (GRCm39) missense probably damaging 1.00
IGL01965:Scn9a APN 2 66,314,777 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,325,170 (GRCm39) missense probably damaging 1.00
IGL02127:Scn9a APN 2 66,377,479 (GRCm39) missense probably damaging 1.00
IGL02166:Scn9a APN 2 66,323,447 (GRCm39) missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66,314,955 (GRCm39) splice site probably benign
IGL02640:Scn9a APN 2 66,366,440 (GRCm39) critical splice donor site probably null
IGL02685:Scn9a APN 2 66,367,637 (GRCm39) missense probably damaging 1.00
IGL02798:Scn9a APN 2 66,370,903 (GRCm39) missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66,398,373 (GRCm39) missense probably damaging 1.00
IGL03008:Scn9a APN 2 66,392,855 (GRCm39) missense probably damaging 1.00
IGL03270:Scn9a APN 2 66,314,358 (GRCm39) missense probably damaging 1.00
IGL03408:Scn9a APN 2 66,357,091 (GRCm39) missense probably benign 0.00
BB007:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
BB017:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R0039:Scn9a UTSW 2 66,392,788 (GRCm39) missense probably damaging 0.98
R0173:Scn9a UTSW 2 66,363,437 (GRCm39) missense probably damaging 1.00
R0323:Scn9a UTSW 2 66,398,475 (GRCm39) missense probably damaging 1.00
R0344:Scn9a UTSW 2 66,335,354 (GRCm39) missense probably damaging 0.99
R0421:Scn9a UTSW 2 66,373,621 (GRCm39) missense probably benign
R0465:Scn9a UTSW 2 66,357,340 (GRCm39) missense probably damaging 1.00
R0514:Scn9a UTSW 2 66,314,022 (GRCm39) missense probably damaging 1.00
R0599:Scn9a UTSW 2 66,357,143 (GRCm39) missense probably damaging 0.96
R0627:Scn9a UTSW 2 66,367,721 (GRCm39) missense probably benign 0.00
R0644:Scn9a UTSW 2 66,363,405 (GRCm39) critical splice donor site probably null
R0653:Scn9a UTSW 2 66,363,721 (GRCm39) missense probably damaging 1.00
R0685:Scn9a UTSW 2 66,313,843 (GRCm39) missense probably benign 0.02
R0718:Scn9a UTSW 2 66,377,456 (GRCm39) missense probably damaging 1.00
R0827:Scn9a UTSW 2 66,366,468 (GRCm39) nonsense probably null
R0890:Scn9a UTSW 2 66,314,079 (GRCm39) missense probably damaging 1.00
R1139:Scn9a UTSW 2 66,335,341 (GRCm39) missense probably benign 0.02
R1385:Scn9a UTSW 2 66,393,886 (GRCm39) missense probably damaging 1.00
R1398:Scn9a UTSW 2 66,314,930 (GRCm39) missense probably benign 0.11
R1496:Scn9a UTSW 2 66,357,232 (GRCm39) missense probably benign
R1511:Scn9a UTSW 2 66,357,157 (GRCm39) missense probably benign 0.01
R1517:Scn9a UTSW 2 66,335,371 (GRCm39) splice site probably benign
R1564:Scn9a UTSW 2 66,314,648 (GRCm39) missense probably damaging 1.00
R1634:Scn9a UTSW 2 66,318,361 (GRCm39) missense probably damaging 1.00
R1662:Scn9a UTSW 2 66,313,803 (GRCm39) missense probably benign 0.00
R1695:Scn9a UTSW 2 66,335,220 (GRCm39) nonsense probably null
R1709:Scn9a UTSW 2 66,313,850 (GRCm39) missense probably damaging 1.00
R1741:Scn9a UTSW 2 66,317,938 (GRCm39) missense probably damaging 0.99
R1755:Scn9a UTSW 2 66,332,060 (GRCm39) missense probably benign 0.38
R1914:Scn9a UTSW 2 66,396,594 (GRCm39) missense probably damaging 1.00
R1962:Scn9a UTSW 2 66,314,655 (GRCm39) missense probably damaging 1.00
R1970:Scn9a UTSW 2 66,345,724 (GRCm39) missense probably damaging 0.97
R2017:Scn9a UTSW 2 66,345,665 (GRCm39) missense probably damaging 0.99
R2092:Scn9a UTSW 2 66,363,720 (GRCm39) missense probably damaging 0.99
R2105:Scn9a UTSW 2 66,398,527 (GRCm39) missense probably benign 0.25
R2114:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2115:Scn9a UTSW 2 66,314,396 (GRCm39) missense probably damaging 1.00
R2128:Scn9a UTSW 2 66,356,998 (GRCm39) missense probably damaging 1.00
R2157:Scn9a UTSW 2 66,366,669 (GRCm39) missense probably damaging 1.00
R2162:Scn9a UTSW 2 66,364,573 (GRCm39) missense probably damaging 0.98
R2350:Scn9a UTSW 2 66,335,312 (GRCm39) missense probably damaging 1.00
R3694:Scn9a UTSW 2 66,392,749 (GRCm39) missense probably benign
R3771:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3772:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3773:Scn9a UTSW 2 66,313,992 (GRCm39) missense probably benign 0.26
R3922:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66,357,217 (GRCm39) missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66,395,398 (GRCm39) intron probably benign
R4385:Scn9a UTSW 2 66,314,900 (GRCm39) missense probably damaging 1.00
R4415:Scn9a UTSW 2 66,357,037 (GRCm39) missense probably damaging 1.00
R4682:Scn9a UTSW 2 66,377,362 (GRCm39) missense probably benign
R4783:Scn9a UTSW 2 66,370,967 (GRCm39) missense probably benign 0.01
R4822:Scn9a UTSW 2 66,314,093 (GRCm39) missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66,382,057 (GRCm39) missense probably benign
R4908:Scn9a UTSW 2 66,357,087 (GRCm39) missense probably benign 0.03
R4983:Scn9a UTSW 2 66,396,614 (GRCm39) missense probably benign 0.02
R5047:Scn9a UTSW 2 66,392,824 (GRCm39) missense probably damaging 1.00
R5100:Scn9a UTSW 2 66,364,463 (GRCm39) missense probably damaging 1.00
R5140:Scn9a UTSW 2 66,395,511 (GRCm39) missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66,318,387 (GRCm39) missense probably damaging 1.00
R5557:Scn9a UTSW 2 66,377,447 (GRCm39) missense probably damaging 0.99
R5582:Scn9a UTSW 2 66,395,373 (GRCm39) intron probably benign
R6108:Scn9a UTSW 2 66,314,393 (GRCm39) missense probably damaging 1.00
R6115:Scn9a UTSW 2 66,393,973 (GRCm39) missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66,317,868 (GRCm39) missense probably benign 0.00
R6261:Scn9a UTSW 2 66,314,240 (GRCm39) missense probably damaging 1.00
R6335:Scn9a UTSW 2 66,398,608 (GRCm39) start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66,357,307 (GRCm39) missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66,313,846 (GRCm39) missense probably benign 0.23
R6681:Scn9a UTSW 2 66,393,686 (GRCm39) missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66,398,373 (GRCm39) missense probably damaging 1.00
R7102:Scn9a UTSW 2 66,379,359 (GRCm39) missense probably damaging 1.00
R7186:Scn9a UTSW 2 66,364,567 (GRCm39) missense probably damaging 1.00
R7243:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R7311:Scn9a UTSW 2 66,314,748 (GRCm39) missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66,314,931 (GRCm39) missense probably benign
R7386:Scn9a UTSW 2 66,370,894 (GRCm39) missense probably damaging 1.00
R7438:Scn9a UTSW 2 66,377,531 (GRCm39) missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66,363,692 (GRCm39) missense probably damaging 0.99
R7485:Scn9a UTSW 2 66,364,561 (GRCm39) missense probably damaging 1.00
R7526:Scn9a UTSW 2 66,313,990 (GRCm39) missense probably benign
R7617:Scn9a UTSW 2 66,370,893 (GRCm39) missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66,366,580 (GRCm39) missense probably benign 0.02
R7653:Scn9a UTSW 2 66,357,424 (GRCm39) missense probably damaging 1.00
R7747:Scn9a UTSW 2 66,314,642 (GRCm39) missense probably damaging 1.00
R7823:Scn9a UTSW 2 66,314,135 (GRCm39) missense probably damaging 1.00
R7864:Scn9a UTSW 2 66,314,904 (GRCm39) missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66,373,456 (GRCm39) missense probably benign 0.00
R7930:Scn9a UTSW 2 66,335,193 (GRCm39) missense probably damaging 0.99
R7975:Scn9a UTSW 2 66,314,597 (GRCm39) missense probably damaging 1.00
R8057:Scn9a UTSW 2 66,345,774 (GRCm39) missense probably benign 0.06
R8145:Scn9a UTSW 2 66,317,754 (GRCm39) missense probably damaging 1.00
R8163:Scn9a UTSW 2 66,314,745 (GRCm39) missense probably damaging 1.00
R8165:Scn9a UTSW 2 66,370,874 (GRCm39) missense probably damaging 1.00
R8342:Scn9a UTSW 2 66,366,626 (GRCm39) missense probably benign
R8345:Scn9a UTSW 2 66,324,966 (GRCm39) missense probably damaging 0.96
R8464:Scn9a UTSW 2 66,396,625 (GRCm39) missense probably damaging 0.99
R8467:Scn9a UTSW 2 66,332,015 (GRCm39) missense probably damaging 1.00
R8698:Scn9a UTSW 2 66,366,628 (GRCm39) missense probably benign 0.00
R8810:Scn9a UTSW 2 66,332,010 (GRCm39) missense probably damaging 1.00
R8822:Scn9a UTSW 2 66,370,979 (GRCm39) missense probably damaging 0.99
R8829:Scn9a UTSW 2 66,313,961 (GRCm39) missense probably benign
R9009:Scn9a UTSW 2 66,338,927 (GRCm39) missense probably damaging 1.00
R9038:Scn9a UTSW 2 66,325,147 (GRCm39) missense probably damaging 1.00
R9126:Scn9a UTSW 2 66,314,744 (GRCm39) missense probably damaging 1.00
R9205:Scn9a UTSW 2 66,363,657 (GRCm39) missense probably damaging 1.00
R9300:Scn9a UTSW 2 66,335,236 (GRCm39) missense probably benign 0.39
R9373:Scn9a UTSW 2 66,314,261 (GRCm39) missense probably benign 0.00
R9404:Scn9a UTSW 2 66,357,040 (GRCm39) missense probably benign 0.02
R9443:Scn9a UTSW 2 66,395,553 (GRCm39) missense probably damaging 1.00
R9590:Scn9a UTSW 2 66,314,328 (GRCm39) missense probably benign 0.05
R9612:Scn9a UTSW 2 66,363,708 (GRCm39) missense probably damaging 1.00
R9617:Scn9a UTSW 2 66,392,809 (GRCm39) missense probably damaging 1.00
R9717:Scn9a UTSW 2 66,357,002 (GRCm39) missense probably benign
X0003:Scn9a UTSW 2 66,338,991 (GRCm39) missense probably benign 0.02
X0062:Scn9a UTSW 2 66,398,421 (GRCm39) missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66,370,936 (GRCm39) missense probably benign 0.00
Z1177:Scn9a UTSW 2 66,325,029 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ACACGAGTGAGTCACCTTCG -3'
(R):5'- TCCTTCTAAAGTGTCCTATGAGCC -3'

Sequencing Primer
(F):5'- CTTCGCAGGCTGTAAACAGTGTATC -3'
(R):5'- AGTGTCCTATGAGCCCATCAC -3'
Posted On 2015-09-24