Incidental Mutation 'R4570:Mybphl'
ID 342064
Institutional Source Beutler Lab
Gene Symbol Mybphl
Ensembl Gene ENSMUSG00000068745
Gene Name myosin binding protein H-like
Synonyms 1110037P11Rik
MMRRC Submission 041794-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R4570 (G1)
Quality Score 129
Status Validated
Chromosome 3
Chromosomal Location 108272227-108287373 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108272347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 12 (C12Y)
Ref Sequence ENSEMBL: ENSMUSP00000088051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090563] [ENSMUST00000102632] [ENSMUST00000135636]
AlphaFold Q5FW53
Predicted Effect possibly damaging
Transcript: ENSMUST00000090563
AA Change: C12Y

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000088051
Gene: ENSMUSG00000068745
AA Change: C12Y

DomainStartEndE-ValueType
IG 61 144 4.67e-4 SMART
FN3 147 229 1.62e-10 SMART
IG 268 352 3.68e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102632
SMART Domains Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
VPS10 131 743 N/A SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129755
Predicted Effect probably benign
Transcript: ENSMUST00000135636
SMART Domains Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747

DomainStartEndE-ValueType
VPS10 1 218 2.3e-5 SMART
transmembrane domain 262 284 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two immunoglobulin superfamily domains and a fibronectin 3 domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 79,842,528 (GRCm39) D1154G probably damaging Het
Acsl5 T A 19: 55,280,206 (GRCm39) I493N probably damaging Het
Adgrf5 T A 17: 43,756,006 (GRCm39) S450T probably benign Het
Ak2 T C 4: 128,895,960 (GRCm39) V79A probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Arfgef2 C A 2: 166,698,458 (GRCm39) Q643K probably damaging Het
Asap3 A G 4: 135,967,496 (GRCm39) D605G probably damaging Het
Ccr5 C T 9: 123,924,912 (GRCm39) Q172* probably null Het
Cpxm2 T C 7: 131,745,435 (GRCm39) D130G probably benign Het
Cspg4b T A 13: 113,454,725 (GRCm39) V257D probably damaging Het
Cxcl12 T C 6: 117,145,633 (GRCm39) V6A probably benign Het
Cyp19a1 G A 9: 54,100,607 (GRCm39) P27S probably benign Het
Dmxl1 T C 18: 49,985,427 (GRCm39) Y225H probably damaging Het
Dzip1l A T 9: 99,529,221 (GRCm39) K317* probably null Het
Edil3 A G 13: 89,280,016 (GRCm39) probably benign Het
Enpep A T 3: 129,075,197 (GRCm39) I707K possibly damaging Het
Fcrlb A G 1: 170,740,189 (GRCm39) probably null Het
Flt1 C T 5: 147,531,423 (GRCm39) A847T probably damaging Het
Fsd2 T C 7: 81,209,518 (GRCm39) D108G probably benign Het
Gemin6 C T 17: 80,535,498 (GRCm39) R153* probably null Het
Gldc T A 19: 30,151,839 (GRCm39) M112L probably benign Het
Gm10267 C T 18: 44,289,492 (GRCm39) M79I probably benign Het
Gm10803 A G 2: 93,394,597 (GRCm39) Y123C unknown Het
Gm28040 C A 1: 133,257,119 (GRCm39) probably benign Het
Gm8674 T A 13: 50,056,570 (GRCm39) noncoding transcript Het
Gprasp1 C T X: 134,703,592 (GRCm39) R1262C probably damaging Het
Hba-a2 T C 11: 32,247,200 (GRCm39) Y141H probably damaging Het
Hmbox1 T A 14: 65,061,111 (GRCm39) I388F possibly damaging Het
Hs6st1 G T 1: 36,142,628 (GRCm39) V188L possibly damaging Het
Ipmk T G 10: 71,208,569 (GRCm39) H118Q probably benign Het
Jhy A G 9: 40,822,389 (GRCm39) I583T probably benign Het
Kcna2 A G 3: 107,012,111 (GRCm39) I231V probably benign Het
Kcnh7 T C 2: 62,667,439 (GRCm39) T367A possibly damaging Het
Kcp A T 6: 29,491,847 (GRCm39) C197* probably null Het
Klra2 C A 6: 131,220,900 (GRCm39) C54F probably damaging Het
Lcn9 T C 2: 25,713,591 (GRCm39) L39P probably benign Het
Lct T C 1: 128,227,641 (GRCm39) N1284S probably benign Het
Map6 T G 7: 98,985,763 (GRCm39) S556A possibly damaging Het
Mdn1 C A 4: 32,741,812 (GRCm39) T3861K probably damaging Het
Mrps12 A G 7: 28,439,388 (GRCm39) L109P probably damaging Het
Mucl3 T C 17: 35,948,883 (GRCm39) T239A possibly damaging Het
Nek9 T C 12: 85,367,508 (GRCm39) K388E probably damaging Het
Nvl A G 1: 180,971,647 (GRCm39) V9A probably benign Het
Obscn T C 11: 58,897,654 (GRCm39) probably null Het
Or2h2 T C 17: 37,396,471 (GRCm39) I195M probably damaging Het
Pik3c3 T A 18: 30,423,603 (GRCm39) I233N possibly damaging Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Ppara A G 15: 85,671,398 (GRCm39) I100V probably benign Het
Rem2 T C 14: 54,715,116 (GRCm39) S98P probably damaging Het
Rpl5-ps2 G T 2: 154,546,156 (GRCm39) noncoding transcript Het
Scmh1 T A 4: 120,385,495 (GRCm39) H623Q probably damaging Het
Scn9a A G 2: 66,313,902 (GRCm39) S1939P possibly damaging Het
Slc6a13 T C 6: 121,313,101 (GRCm39) probably null Het
Slc7a4 G A 16: 17,392,141 (GRCm39) T431I probably benign Het
Snupn A G 9: 56,885,346 (GRCm39) E217G probably benign Het
Spopl T A 2: 23,427,497 (GRCm39) K212* probably null Het
Strn T A 17: 78,984,801 (GRCm39) T281S possibly damaging Het
Supt3 T A 17: 45,352,116 (GRCm39) L265* probably null Het
Taf5l G A 8: 124,724,289 (GRCm39) T510M probably damaging Het
Tapbp C A 17: 34,145,427 (GRCm39) D415E probably damaging Het
Tarbp1 A T 8: 127,178,972 (GRCm39) D702E probably benign Het
Tfap2c C A 2: 172,399,247 (GRCm39) P473Q probably damaging Het
Tnc T C 4: 63,913,909 (GRCm39) N1301S probably damaging Het
Trim33 A G 3: 103,237,481 (GRCm39) Q179R probably damaging Het
Txnrd2 A G 16: 18,287,554 (GRCm39) N335S probably benign Het
Uggt1 T A 1: 36,189,154 (GRCm39) D1444V probably damaging Het
Ugt3a1 T C 15: 9,338,807 (GRCm39) L57P probably benign Het
Vmn2r6 A T 3: 64,467,068 (GRCm39) W144R probably benign Het
Vmn2r98 T A 17: 19,286,354 (GRCm39) M284K probably benign Het
Zfp558 A T 9: 18,367,799 (GRCm39) C330S possibly damaging Het
Zfp703 T C 8: 27,468,981 (GRCm39) V215A probably benign Het
Other mutations in Mybphl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03365:Mybphl APN 3 108,272,314 (GRCm39) start codon destroyed probably null 0.98
IGL03389:Mybphl APN 3 108,283,034 (GRCm39) missense probably benign 0.09
R0194:Mybphl UTSW 3 108,281,484 (GRCm39) missense probably benign 0.01
R0206:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R0206:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R0208:Mybphl UTSW 3 108,282,731 (GRCm39) missense probably damaging 1.00
R1067:Mybphl UTSW 3 108,272,319 (GRCm39) missense probably benign
R1223:Mybphl UTSW 3 108,282,512 (GRCm39) missense possibly damaging 0.81
R1748:Mybphl UTSW 3 108,282,400 (GRCm39) critical splice acceptor site probably null
R2013:Mybphl UTSW 3 108,282,718 (GRCm39) missense probably benign 0.02
R2102:Mybphl UTSW 3 108,282,949 (GRCm39) missense possibly damaging 0.82
R2121:Mybphl UTSW 3 108,282,492 (GRCm39) missense probably damaging 1.00
R2197:Mybphl UTSW 3 108,284,635 (GRCm39) missense probably damaging 1.00
R2265:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2266:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2267:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R2268:Mybphl UTSW 3 108,272,317 (GRCm39) missense probably damaging 1.00
R4551:Mybphl UTSW 3 108,281,479 (GRCm39) missense possibly damaging 0.49
R4693:Mybphl UTSW 3 108,282,494 (GRCm39) missense probably benign 0.01
R5759:Mybphl UTSW 3 108,282,070 (GRCm39) missense probably benign 0.30
R7017:Mybphl UTSW 3 108,282,154 (GRCm39) missense probably damaging 0.99
R7526:Mybphl UTSW 3 108,281,496 (GRCm39) missense probably benign 0.00
R8266:Mybphl UTSW 3 108,284,676 (GRCm39) missense probably damaging 1.00
R8976:Mybphl UTSW 3 108,272,334 (GRCm39) missense probably damaging 1.00
R9440:Mybphl UTSW 3 108,282,202 (GRCm39) missense probably benign 0.19
R9617:Mybphl UTSW 3 108,282,952 (GRCm39) missense possibly damaging 0.68
R9655:Mybphl UTSW 3 108,282,099 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGGGCAGCTCTCTGATC -3'
(R):5'- AGTAGGAAGTTCCCCTCTCC -3'

Sequencing Primer
(F):5'- GGCAGCTCTCTGATCCTCCTC -3'
(R):5'- GGAAGTTCCCCTCTCCCACAC -3'
Posted On 2015-09-24