Incidental Mutation 'R4570:Flt1'
ID342071
Institutional Source Beutler Lab
Gene Symbol Flt1
Ensembl Gene ENSMUSG00000029648
Gene NameFMS-like tyrosine kinase 1
SynonymsFlt-1, VEGFR1, vascular endothelial growth factor receptor-1, sFlt1, VEGFR-1
MMRRC Submission 041794-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4570 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location147561604-147726011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 147594613 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 847 (A847T)
Ref Sequence ENSEMBL: ENSMUSP00000031653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031653]
Predicted Effect probably damaging
Transcript: ENSMUST00000031653
AA Change: A847T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031653
Gene: ENSMUSG00000029648
AA Change: A847T

DomainStartEndE-ValueType
IG 38 130 1.74e-3 SMART
IG 144 225 1.49e-2 SMART
IG 238 330 2.23e-10 SMART
IG 345 426 2.43e-2 SMART
IG 440 554 2.6e-2 SMART
IGc2 569 644 1.76e-8 SMART
IGc2 674 739 6.29e-19 SMART
low complexity region 769 786 N/A INTRINSIC
TyrKc 828 1154 9.54e-144 SMART
Meta Mutation Damage Score 0.2721 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vascular endothelial growth factor receptor (VEGFR) family. VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR-A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Isoforms include a full-length transmembrane receptor isoform and shortened, soluble isoforms. The soluble isoforms are associated with the onset of pre-eclampsia.[provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an excess of hemangioblasts resulting in an overgrowth of endothelial cells, abnormalities of vascular channels and blood islands, and lethality at the mid-somite developmental stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,694 D1154G probably damaging Het
Acsl5 T A 19: 55,291,774 I493N probably damaging Het
Adgrf5 T A 17: 43,445,115 S450T probably benign Het
Ak2 T C 4: 129,002,167 V79A probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arfgef2 C A 2: 166,856,538 Q643K probably damaging Het
Asap3 A G 4: 136,240,185 D605G probably damaging Het
BC067074 T A 13: 113,318,191 V257D probably damaging Het
Ccr5 C T 9: 124,124,875 Q172* probably null Het
Cpxm2 T C 7: 132,143,706 D130G probably benign Het
Cxcl12 T C 6: 117,168,672 V6A probably benign Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dpcr1 T C 17: 35,637,991 T239A possibly damaging Het
Dzip1l A T 9: 99,647,168 K317* probably null Het
Edil3 A G 13: 89,131,897 probably benign Het
Enpep A T 3: 129,281,548 I707K possibly damaging Het
Fcrlb A G 1: 170,912,620 probably null Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Gemin6 C T 17: 80,228,069 R153* probably null Het
Gldc T A 19: 30,174,439 M112L probably benign Het
Gm10267 C T 18: 44,156,425 M79I probably benign Het
Gm10803 A G 2: 93,564,252 Y123C unknown Het
Gm28040 C A 1: 133,329,381 probably benign Het
Gm8674 T A 13: 49,902,534 noncoding transcript Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Hba-a2 T C 11: 32,297,200 Y141H probably damaging Het
Hmbox1 T A 14: 64,823,662 I388F possibly damaging Het
Hs6st1 G T 1: 36,103,547 V188L possibly damaging Het
Ipmk T G 10: 71,372,739 H118Q probably benign Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Kcna2 A G 3: 107,104,795 I231V probably benign Het
Kcnh7 T C 2: 62,837,095 T367A possibly damaging Het
Kcp A T 6: 29,491,848 C197* probably null Het
Klra2 C A 6: 131,243,937 C54F probably damaging Het
Lcn9 T C 2: 25,823,579 L39P probably benign Het
Lct T C 1: 128,299,904 N1284S probably benign Het
Map6 T G 7: 99,336,556 S556A possibly damaging Het
Mdn1 C A 4: 32,741,812 T3861K probably damaging Het
Mrps12 A G 7: 28,739,963 L109P probably damaging Het
Mybphl G A 3: 108,365,031 C12Y possibly damaging Het
Nek9 T C 12: 85,320,734 K388E probably damaging Het
Nvl A G 1: 181,144,082 V9A probably benign Het
Obscn T C 11: 59,006,828 probably null Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pik3c3 T A 18: 30,290,550 I233N possibly damaging Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppara A G 15: 85,787,197 I100V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Scmh1 T A 4: 120,528,298 H623Q probably damaging Het
Scn9a A G 2: 66,483,558 S1939P possibly damaging Het
Slc6a13 T C 6: 121,336,142 probably null Het
Slc7a4 G A 16: 17,574,277 T431I probably benign Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Spopl T A 2: 23,537,485 K212* probably null Het
Strn T A 17: 78,677,372 T281S possibly damaging Het
Supt3 T A 17: 45,041,229 L265* probably null Het
Taf5l G A 8: 123,997,550 T510M probably damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Tarbp1 A T 8: 126,452,233 D702E probably benign Het
Tfap2c C A 2: 172,557,327 P473Q probably damaging Het
Tnc T C 4: 63,995,672 N1301S probably damaging Het
Trim33 A G 3: 103,330,165 Q179R probably damaging Het
Txnrd2 A G 16: 18,468,804 N335S probably benign Het
Uggt1 T A 1: 36,150,073 D1444V probably damaging Het
Ugt3a2 T C 15: 9,338,721 L57P probably benign Het
Vmn2r6 A T 3: 64,559,647 W144R probably benign Het
Vmn2r98 T A 17: 19,066,092 M284K probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp703 T C 8: 26,978,953 V215A probably benign Het
Other mutations in Flt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Flt1 APN 5 147580300 critical splice donor site probably null
IGL00469:Flt1 APN 5 147603605 missense probably damaging 0.99
IGL00897:Flt1 APN 5 147589854 missense probably benign 0.25
IGL01111:Flt1 APN 5 147578336 missense probably damaging 1.00
IGL01154:Flt1 APN 5 147576156 missense possibly damaging 0.63
IGL01744:Flt1 APN 5 147571461 missense probably benign 0.01
IGL01973:Flt1 APN 5 147683889 missense probably benign 0.01
IGL02079:Flt1 APN 5 147568831 splice site probably benign
IGL02143:Flt1 APN 5 147578436 missense probably benign 0.00
IGL02156:Flt1 APN 5 147681741 missense probably damaging 0.99
IGL02345:Flt1 APN 5 147582626 missense probably benign 0.20
IGL02548:Flt1 APN 5 147639248 missense probably benign 0.00
IGL02631:Flt1 APN 5 147673574 nonsense probably null
IGL02686:Flt1 APN 5 147588602 missense probably damaging 1.00
IGL02938:Flt1 APN 5 147678299 missense possibly damaging 0.47
IGL03057:Flt1 APN 5 147681924 nonsense probably null
IGL03196:Flt1 APN 5 147615127 critical splice donor site probably null
IGL03205:Flt1 APN 5 147699821 missense probably benign 0.00
IGL03255:Flt1 APN 5 147588521 splice site probably benign
flywheels UTSW 5 147599646 missense probably damaging 1.00
BB008:Flt1 UTSW 5 147588572 missense probably damaging 1.00
BB018:Flt1 UTSW 5 147588572 missense probably damaging 1.00
IGL02837:Flt1 UTSW 5 147655170 missense probably benign 0.32
PIT4402001:Flt1 UTSW 5 147678239 missense probably damaging 1.00
R0013:Flt1 UTSW 5 147571014 splice site probably benign
R0380:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R0448:Flt1 UTSW 5 147566394 splice site probably benign
R0789:Flt1 UTSW 5 147639483 missense probably damaging 1.00
R1005:Flt1 UTSW 5 147681885 missense probably damaging 0.99
R1241:Flt1 UTSW 5 147599646 missense probably damaging 1.00
R1302:Flt1 UTSW 5 147564240 missense possibly damaging 0.93
R1411:Flt1 UTSW 5 147580316 missense probably damaging 1.00
R1615:Flt1 UTSW 5 147639288 missense probably damaging 1.00
R1634:Flt1 UTSW 5 147676430 missense probably damaging 1.00
R1749:Flt1 UTSW 5 147655119 missense probably benign 0.00
R1768:Flt1 UTSW 5 147672709 missense probably damaging 1.00
R1972:Flt1 UTSW 5 147655093 splice site probably benign
R2074:Flt1 UTSW 5 147599606 missense possibly damaging 0.82
R2081:Flt1 UTSW 5 147639422 missense probably damaging 1.00
R2864:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R2865:Flt1 UTSW 5 147594621 missense possibly damaging 0.68
R3740:Flt1 UTSW 5 147599593 missense probably damaging 1.00
R3820:Flt1 UTSW 5 147700017 splice site probably benign
R4089:Flt1 UTSW 5 147564241 missense probably benign 0.03
R4299:Flt1 UTSW 5 147683907 missense probably benign 0.00
R4812:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4853:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4865:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4900:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4906:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4907:Flt1 UTSW 5 147683939 missense probably benign 0.30
R4909:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5072:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5073:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5074:Flt1 UTSW 5 147683939 missense probably benign 0.30
R5218:Flt1 UTSW 5 147681928 missense probably damaging 1.00
R5547:Flt1 UTSW 5 147655138 missense probably damaging 1.00
R5731:Flt1 UTSW 5 147678152 missense probably benign 0.16
R5732:Flt1 UTSW 5 147634483 nonsense probably null
R5804:Flt1 UTSW 5 147580437 splice site probably null
R6107:Flt1 UTSW 5 147603593 missense probably benign 0.15
R6440:Flt1 UTSW 5 147564305 missense possibly damaging 0.79
R6453:Flt1 UTSW 5 147683941 missense possibly damaging 0.80
R6539:Flt1 UTSW 5 147578376 missense probably benign 0.27
R7068:Flt1 UTSW 5 147673634 missense probably damaging 1.00
R7112:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7195:Flt1 UTSW 5 147603576 missense probably damaging 1.00
R7255:Flt1 UTSW 5 147580406 missense probably damaging 1.00
R7347:Flt1 UTSW 5 147580381 missense probably damaging 1.00
R7469:Flt1 UTSW 5 147603569 missense probably damaging 1.00
R7473:Flt1 UTSW 5 147594595 missense probably damaging 1.00
R7663:Flt1 UTSW 5 147655120 missense probably benign
R7688:Flt1 UTSW 5 147676325 missense probably benign
R7729:Flt1 UTSW 5 147700367 missense probably benign 0.00
R7931:Flt1 UTSW 5 147588572 missense probably damaging 1.00
R8051:Flt1 UTSW 5 147582691 missense probably benign 0.02
R8275:Flt1 UTSW 5 147678147 missense probably damaging 0.99
X0064:Flt1 UTSW 5 147673613 missense probably damaging 1.00
Z1088:Flt1 UTSW 5 147681649 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CGGGTCGTTTCATTGGCAAG -3'
(R):5'- ACGGAATCCCTTTCAAAGATGC -3'

Sequencing Primer
(F):5'- CATTGGCAAGGTTTATTCTGAGC -3'
(R):5'- TCAAAGATGCGCACTTTGC -3'
Posted On2015-09-24