Incidental Mutation 'R4570:Cyp19a1'
ID342084
Institutional Source Beutler Lab
Gene Symbol Cyp19a1
Ensembl Gene ENSMUSG00000032274
Gene Namecytochrome P450, family 19, subfamily a, polypeptide 1
SynonymsCyp19, ArKO, Int-5, aromatase, p450arom, Int5, Ar
MMRRC Submission 041794-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4570 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54165937-54268110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54193323 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 27 (P27S)
Ref Sequence ENSEMBL: ENSMUSP00000034811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034811] [ENSMUST00000215736]
Predicted Effect probably benign
Transcript: ENSMUST00000034811
AA Change: P27S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000034811
Gene: ENSMUSG00000032274
AA Change: P27S

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
Pfam:p450 46 488 1e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214358
Predicted Effect probably benign
Transcript: ENSMUST00000215736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216974
Meta Mutation Damage Score 0.0855 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for various mutations that inactivate the gene exhibit defects affecting fertility including impairments of ovulation, spermiogenesis and mounting behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,694 D1154G probably damaging Het
Acsl5 T A 19: 55,291,774 I493N probably damaging Het
Adgrf5 T A 17: 43,445,115 S450T probably benign Het
Ak2 T C 4: 129,002,167 V79A probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arfgef2 C A 2: 166,856,538 Q643K probably damaging Het
Asap3 A G 4: 136,240,185 D605G probably damaging Het
BC067074 T A 13: 113,318,191 V257D probably damaging Het
Ccr5 C T 9: 124,124,875 Q172* probably null Het
Cpxm2 T C 7: 132,143,706 D130G probably benign Het
Cxcl12 T C 6: 117,168,672 V6A probably benign Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dpcr1 T C 17: 35,637,991 T239A possibly damaging Het
Dzip1l A T 9: 99,647,168 K317* probably null Het
Edil3 A G 13: 89,131,897 probably benign Het
Enpep A T 3: 129,281,548 I707K possibly damaging Het
Fcrlb A G 1: 170,912,620 probably null Het
Flt1 C T 5: 147,594,613 A847T probably damaging Het
Fsd2 T C 7: 81,559,770 D108G probably benign Het
Gemin6 C T 17: 80,228,069 R153* probably null Het
Gldc T A 19: 30,174,439 M112L probably benign Het
Gm10267 C T 18: 44,156,425 M79I probably benign Het
Gm10803 A G 2: 93,564,252 Y123C unknown Het
Gm28040 C A 1: 133,329,381 probably benign Het
Gm8674 T A 13: 49,902,534 noncoding transcript Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Hba-a2 T C 11: 32,297,200 Y141H probably damaging Het
Hmbox1 T A 14: 64,823,662 I388F possibly damaging Het
Hs6st1 G T 1: 36,103,547 V188L possibly damaging Het
Ipmk T G 10: 71,372,739 H118Q probably benign Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Kcna2 A G 3: 107,104,795 I231V probably benign Het
Kcnh7 T C 2: 62,837,095 T367A possibly damaging Het
Kcp A T 6: 29,491,848 C197* probably null Het
Klra2 C A 6: 131,243,937 C54F probably damaging Het
Lcn9 T C 2: 25,823,579 L39P probably benign Het
Lct T C 1: 128,299,904 N1284S probably benign Het
Map6 T G 7: 99,336,556 S556A possibly damaging Het
Mdn1 C A 4: 32,741,812 T3861K probably damaging Het
Mrps12 A G 7: 28,739,963 L109P probably damaging Het
Mybphl G A 3: 108,365,031 C12Y possibly damaging Het
Nek9 T C 12: 85,320,734 K388E probably damaging Het
Nvl A G 1: 181,144,082 V9A probably benign Het
Obscn T C 11: 59,006,828 probably null Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pik3c3 T A 18: 30,290,550 I233N possibly damaging Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Ppara A G 15: 85,787,197 I100V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Scmh1 T A 4: 120,528,298 H623Q probably damaging Het
Scn9a A G 2: 66,483,558 S1939P possibly damaging Het
Slc6a13 T C 6: 121,336,142 probably null Het
Slc7a4 G A 16: 17,574,277 T431I probably benign Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Spopl T A 2: 23,537,485 K212* probably null Het
Strn T A 17: 78,677,372 T281S possibly damaging Het
Supt3 T A 17: 45,041,229 L265* probably null Het
Taf5l G A 8: 123,997,550 T510M probably damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Tarbp1 A T 8: 126,452,233 D702E probably benign Het
Tfap2c C A 2: 172,557,327 P473Q probably damaging Het
Tnc T C 4: 63,995,672 N1301S probably damaging Het
Trim33 A G 3: 103,330,165 Q179R probably damaging Het
Txnrd2 A G 16: 18,468,804 N335S probably benign Het
Uggt1 T A 1: 36,150,073 D1444V probably damaging Het
Ugt3a2 T C 15: 9,338,721 L57P probably benign Het
Vmn2r6 A T 3: 64,559,647 W144R probably benign Het
Vmn2r98 T A 17: 19,066,092 M284K probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp703 T C 8: 26,978,953 V215A probably benign Het
Other mutations in Cyp19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Cyp19a1 APN 9 54168529 missense probably benign 0.03
IGL02885:Cyp19a1 APN 9 54171818 missense probably benign 0.25
IGL02897:Cyp19a1 APN 9 54166911 missense possibly damaging 0.95
R0384:Cyp19a1 UTSW 9 54172741 missense probably benign 0.01
R3104:Cyp19a1 UTSW 9 54186799 missense probably benign 0.00
R4116:Cyp19a1 UTSW 9 54168741 missense possibly damaging 0.94
R4158:Cyp19a1 UTSW 9 54186696 missense probably damaging 1.00
R4160:Cyp19a1 UTSW 9 54186696 missense probably damaging 1.00
R4555:Cyp19a1 UTSW 9 54166821 missense probably damaging 0.96
R4569:Cyp19a1 UTSW 9 54193323 missense probably benign 0.06
R4693:Cyp19a1 UTSW 9 54173333 missense possibly damaging 0.55
R4807:Cyp19a1 UTSW 9 54176646 missense possibly damaging 0.89
R4853:Cyp19a1 UTSW 9 54166776 missense probably benign
R4938:Cyp19a1 UTSW 9 54173363 missense probably benign 0.01
R5272:Cyp19a1 UTSW 9 54176614 missense probably benign 0.19
R6148:Cyp19a1 UTSW 9 54180256 missense probably damaging 1.00
R7008:Cyp19a1 UTSW 9 54193325 missense probably benign 0.35
R7472:Cyp19a1 UTSW 9 54166993 missense possibly damaging 0.55
X0025:Cyp19a1 UTSW 9 54168568 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGTGCTTCTTCTTCGAAG -3'
(R):5'- ATCCAGCACCCTTCCAAGTG -3'

Sequencing Primer
(F):5'- GCCCCGTGAAACTCTTTC -3'
(R):5'- GAAATGCTGAACCCCATG -3'
Posted On2015-09-24