Mutagenetix > Incidental Mutations

Incidental Mutation 'R4570:Cyp19a1'

342084

Institutional Source

Beutler Lab

Gene Symbol

Cyp19a1

Ensembl Gene

ENSMUSG00000032274

Gene Name

cytochrome P450, family 19, subfamily a, polypeptide 1

Synonyms

Cyp19, ArKO, Int-5, aromatase, p450arom, Int5, Ar

MMRRC Submission

041794-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4570 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

54165937-54268110 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 54193323 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 27 (P27S)

Ref Sequence

ENSEMBL: ENSMUSP00000034811 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034811] [ENSMUST00000215736]

Predicted Effect

probably benign
Transcript: ENSMUST00000034811
AA Change: P27S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000034811
Gene: ENSMUSG00000032274
AA Change: P27S

Domain	Start	End	E-Value	Type
low complexity region	28	38	N/A	INTRINSIC
Pfam:p450	46	488	1e-106	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214358

Predicted Effect

probably benign
Transcript: ENSMUST00000215736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216974

Meta Mutation Damage Score

0.0855

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

99% (78/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for various mutations that inactivate the gene exhibit defects affecting fertility including impairments of ovulation, spermiogenesis and mounting behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	A	G	10: 80,006,694	D1154G	probably damaging	Het
Acsl5	T	A	19: 55,291,774	I493N	probably damaging	Het
Adgrf5	T	A	17: 43,445,115	S450T	probably benign	Het
Ak2	T	C	4: 129,002,167	V79A	probably damaging	Het
Alkbh2	C	T	5: 114,124,226	E148K	probably damaging	Het
Arfgef2	C	A	2: 166,856,538	Q643K	probably damaging	Het
Asap3	A	G	4: 136,240,185	D605G	probably damaging	Het
BC067074	T	A	13: 113,318,191	V257D	probably damaging	Het
Ccr5	C	T	9: 124,124,875	Q172*	probably null	Het
Cpxm2	T	C	7: 132,143,706	D130G	probably benign	Het
Cxcl12	T	C	6: 117,168,672	V6A	probably benign	Het
Dmxl1	T	C	18: 49,852,360	Y225H	probably damaging	Het
Dpcr1	T	C	17: 35,637,991	T239A	possibly damaging	Het
Dzip1l	A	T	9: 99,647,168	K317*	probably null	Het
Edil3	A	G	13: 89,131,897		probably benign	Het
Enpep	A	T	3: 129,281,548	I707K	possibly damaging	Het
Fcrlb	A	G	1: 170,912,620		probably null	Het
Flt1	C	T	5: 147,594,613	A847T	probably damaging	Het
Fsd2	T	C	7: 81,559,770	D108G	probably benign	Het
Gemin6	C	T	17: 80,228,069	R153*	probably null	Het
Gldc	T	A	19: 30,174,439	M112L	probably benign	Het
Gm10267	C	T	18: 44,156,425	M79I	probably benign	Het
Gm10803	A	G	2: 93,564,252	Y123C	unknown	Het
Gm28040	C	A	1: 133,329,381		probably benign	Het
Gm8674	T	A	13: 49,902,534		noncoding transcript	Het
Gprasp1	C	T	X: 135,802,843	R1262C	probably damaging	Het
Hba-a2	T	C	11: 32,297,200	Y141H	probably damaging	Het
Hmbox1	T	A	14: 64,823,662	I388F	possibly damaging	Het
Hs6st1	G	T	1: 36,103,547	V188L	possibly damaging	Het
Ipmk	T	G	10: 71,372,739	H118Q	probably benign	Het
Jhy	A	G	9: 40,911,093	I583T	probably benign	Het
Kcna2	A	G	3: 107,104,795	I231V	probably benign	Het
Kcnh7	T	C	2: 62,837,095	T367A	possibly damaging	Het
Kcp	A	T	6: 29,491,848	C197*	probably null	Het
Klra2	C	A	6: 131,243,937	C54F	probably damaging	Het
Lcn9	T	C	2: 25,823,579	L39P	probably benign	Het
Lct	T	C	1: 128,299,904	N1284S	probably benign	Het
Map6	T	G	7: 99,336,556	S556A	possibly damaging	Het
Mdn1	C	A	4: 32,741,812	T3861K	probably damaging	Het
Mrps12	A	G	7: 28,739,963	L109P	probably damaging	Het
Mybphl	G	A	3: 108,365,031	C12Y	possibly damaging	Het
Nek9	T	C	12: 85,320,734	K388E	probably damaging	Het
Nvl	A	G	1: 181,144,082	V9A	probably benign	Het
Obscn	T	C	11: 59,006,828		probably null	Het
Olfr90	T	C	17: 37,085,579	I195M	probably damaging	Het
Pik3c3	T	A	18: 30,290,550	I233N	possibly damaging	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Ppara	A	G	15: 85,787,197	I100V	probably benign	Het
Rem2	T	C	14: 54,477,659	S98P	probably damaging	Het
Rpl5-ps2	G	T	2: 154,704,236		noncoding transcript	Het
Scmh1	T	A	4: 120,528,298	H623Q	probably damaging	Het
Scn9a	A	G	2: 66,483,558	S1939P	possibly damaging	Het
Slc6a13	T	C	6: 121,336,142		probably null	Het
Slc7a4	G	A	16: 17,574,277	T431I	probably benign	Het
Snupn	A	G	9: 56,978,062	E217G	probably benign	Het
Spopl	T	A	2: 23,537,485	K212*	probably null	Het
Strn	T	A	17: 78,677,372	T281S	possibly damaging	Het
Supt3	T	A	17: 45,041,229	L265*	probably null	Het
Taf5l	G	A	8: 123,997,550	T510M	probably damaging	Het
Tapbp	C	A	17: 33,926,453	D415E	probably damaging	Het
Tarbp1	A	T	8: 126,452,233	D702E	probably benign	Het
Tfap2c	C	A	2: 172,557,327	P473Q	probably damaging	Het
Tnc	T	C	4: 63,995,672	N1301S	probably damaging	Het
Trim33	A	G	3: 103,330,165	Q179R	probably damaging	Het
Txnrd2	A	G	16: 18,468,804	N335S	probably benign	Het
Uggt1	T	A	1: 36,150,073	D1444V	probably damaging	Het
Ugt3a2	T	C	15: 9,338,721	L57P	probably benign	Het
Vmn2r6	A	T	3: 64,559,647	W144R	probably benign	Het
Vmn2r98	T	A	17: 19,066,092	M284K	probably benign	Het
Zfp558	A	T	9: 18,456,503	C330S	possibly damaging	Het
Zfp703	T	C	8: 26,978,953	V215A	probably benign	Het

Other mutations in Cyp19a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01897:Cyp19a1	APN	9	54168529	missense	probably benign	0.03
IGL02885:Cyp19a1	APN	9	54171818	missense	probably benign	0.25
IGL02897:Cyp19a1	APN	9	54166911	missense	possibly damaging	0.95
R0384:Cyp19a1	UTSW	9	54172741	missense	probably benign	0.01
R3104:Cyp19a1	UTSW	9	54186799	missense	probably benign	0.00
R4116:Cyp19a1	UTSW	9	54168741	missense	possibly damaging	0.94
R4158:Cyp19a1	UTSW	9	54186696	missense	probably damaging	1.00
R4160:Cyp19a1	UTSW	9	54186696	missense	probably damaging	1.00
R4555:Cyp19a1	UTSW	9	54166821	missense	probably damaging	0.96
R4569:Cyp19a1	UTSW	9	54193323	missense	probably benign	0.06
R4693:Cyp19a1	UTSW	9	54173333	missense	possibly damaging	0.55
R4807:Cyp19a1	UTSW	9	54176646	missense	possibly damaging	0.89
R4853:Cyp19a1	UTSW	9	54166776	missense	probably benign
R4938:Cyp19a1	UTSW	9	54173363	missense	probably benign	0.01
R5272:Cyp19a1	UTSW	9	54176614	missense	probably benign	0.19
R6148:Cyp19a1	UTSW	9	54180256	missense	probably damaging	1.00
R7008:Cyp19a1	UTSW	9	54193325	missense	probably benign	0.35
R7472:Cyp19a1	UTSW	9	54166993	missense	possibly damaging	0.55
X0025:Cyp19a1	UTSW	9	54168568	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCTGTGCTTCTTCTTCGAAG -3'
(R):5'- ATCCAGCACCCTTCCAAGTG -3'

Sequencing Primer
(F):5'- GCCCCGTGAAACTCTTTC -3'
(R):5'- GAAATGCTGAACCCCATG -3'

Posted On

2015-09-24