Incidental Mutation 'R4570:Dmxl1'
ID 342111
Institutional Source Beutler Lab
Gene Symbol Dmxl1
Ensembl Gene ENSMUSG00000037416
Gene Name Dmx-like 1
Synonyms C630007L23Rik
MMRRC Submission 041794-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R4570 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 49965737-50098540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49985427 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 225 (Y225H)
Ref Sequence ENSEMBL: ENSMUSP00000137871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041772] [ENSMUST00000180611]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000041772
AA Change: Y225H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045559
Gene: ENSMUSG00000037416
AA Change: Y225H

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
Pfam:Rav1p_C 1102 1877 4.3e-84 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2371 2385 N/A INTRINSIC
low complexity region 2397 2410 N/A INTRINSIC
low complexity region 2449 2466 N/A INTRINSIC
WD40 2735 2770 1.07e1 SMART
WD40 2773 2813 3.7e0 SMART
WD40 2825 2867 1.07e0 SMART
WD40 2873 2912 1.05e-2 SMART
WD40 2915 2954 4.51e-7 SMART
Blast:WD40 2957 3005 9e-26 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000180611
AA Change: Y225H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137871
Gene: ENSMUSG00000037416
AA Change: Y225H

DomainStartEndE-ValueType
WD40 100 136 8.22e1 SMART
WD40 156 195 2.88e-1 SMART
WD40 218 266 8.29e-1 SMART
low complexity region 367 378 N/A INTRINSIC
WD40 464 505 1.53e2 SMART
Blast:WD40 719 772 1e-25 BLAST
WD40 957 999 1.1e1 SMART
low complexity region 1195 1206 N/A INTRINSIC
low complexity region 1258 1271 N/A INTRINSIC
Pfam:Rav1p_C 1287 1876 9.4e-72 PFAM
low complexity region 1922 1942 N/A INTRINSIC
low complexity region 1966 1975 N/A INTRINSIC
low complexity region 1993 2007 N/A INTRINSIC
low complexity region 2147 2158 N/A INTRINSIC
low complexity region 2385 2398 N/A INTRINSIC
low complexity region 2437 2454 N/A INTRINSIC
WD40 2723 2758 1.07e1 SMART
WD40 2761 2801 3.7e0 SMART
WD40 2813 2855 1.07e0 SMART
WD40 2861 2900 1.05e-2 SMART
WD40 2903 2942 4.51e-7 SMART
Blast:WD40 2945 2993 9e-26 BLAST
Meta Mutation Damage Score 0.7056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (78/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD repeat superfamily of proteins, which have regulatory functions. This gene is expressed in many tissue types including several types of eye tissue, and it has been associated with ocular phenotypes. In addition, it is upregulated in cultured cells that overexpress growth factor independence 1B, a transcription factor that is essential for hematopoietic cell development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 79,842,528 (GRCm39) D1154G probably damaging Het
Acsl5 T A 19: 55,280,206 (GRCm39) I493N probably damaging Het
Adgrf5 T A 17: 43,756,006 (GRCm39) S450T probably benign Het
Ak2 T C 4: 128,895,960 (GRCm39) V79A probably damaging Het
Alkbh2 C T 5: 114,262,287 (GRCm39) E148K probably damaging Het
Arfgef2 C A 2: 166,698,458 (GRCm39) Q643K probably damaging Het
Asap3 A G 4: 135,967,496 (GRCm39) D605G probably damaging Het
Ccr5 C T 9: 123,924,912 (GRCm39) Q172* probably null Het
Cpxm2 T C 7: 131,745,435 (GRCm39) D130G probably benign Het
Cspg4b T A 13: 113,454,725 (GRCm39) V257D probably damaging Het
Cxcl12 T C 6: 117,145,633 (GRCm39) V6A probably benign Het
Cyp19a1 G A 9: 54,100,607 (GRCm39) P27S probably benign Het
Dzip1l A T 9: 99,529,221 (GRCm39) K317* probably null Het
Edil3 A G 13: 89,280,016 (GRCm39) probably benign Het
Enpep A T 3: 129,075,197 (GRCm39) I707K possibly damaging Het
Fcrlb A G 1: 170,740,189 (GRCm39) probably null Het
Flt1 C T 5: 147,531,423 (GRCm39) A847T probably damaging Het
Fsd2 T C 7: 81,209,518 (GRCm39) D108G probably benign Het
Gemin6 C T 17: 80,535,498 (GRCm39) R153* probably null Het
Gldc T A 19: 30,151,839 (GRCm39) M112L probably benign Het
Gm10267 C T 18: 44,289,492 (GRCm39) M79I probably benign Het
Gm10803 A G 2: 93,394,597 (GRCm39) Y123C unknown Het
Gm28040 C A 1: 133,257,119 (GRCm39) probably benign Het
Gm8674 T A 13: 50,056,570 (GRCm39) noncoding transcript Het
Gprasp1 C T X: 134,703,592 (GRCm39) R1262C probably damaging Het
Hba-a2 T C 11: 32,247,200 (GRCm39) Y141H probably damaging Het
Hmbox1 T A 14: 65,061,111 (GRCm39) I388F possibly damaging Het
Hs6st1 G T 1: 36,142,628 (GRCm39) V188L possibly damaging Het
Ipmk T G 10: 71,208,569 (GRCm39) H118Q probably benign Het
Jhy A G 9: 40,822,389 (GRCm39) I583T probably benign Het
Kcna2 A G 3: 107,012,111 (GRCm39) I231V probably benign Het
Kcnh7 T C 2: 62,667,439 (GRCm39) T367A possibly damaging Het
Kcp A T 6: 29,491,847 (GRCm39) C197* probably null Het
Klra2 C A 6: 131,220,900 (GRCm39) C54F probably damaging Het
Lcn9 T C 2: 25,713,591 (GRCm39) L39P probably benign Het
Lct T C 1: 128,227,641 (GRCm39) N1284S probably benign Het
Map6 T G 7: 98,985,763 (GRCm39) S556A possibly damaging Het
Mdn1 C A 4: 32,741,812 (GRCm39) T3861K probably damaging Het
Mrps12 A G 7: 28,439,388 (GRCm39) L109P probably damaging Het
Mucl3 T C 17: 35,948,883 (GRCm39) T239A possibly damaging Het
Mybphl G A 3: 108,272,347 (GRCm39) C12Y possibly damaging Het
Nek9 T C 12: 85,367,508 (GRCm39) K388E probably damaging Het
Nvl A G 1: 180,971,647 (GRCm39) V9A probably benign Het
Obscn T C 11: 58,897,654 (GRCm39) probably null Het
Or2h2 T C 17: 37,396,471 (GRCm39) I195M probably damaging Het
Pik3c3 T A 18: 30,423,603 (GRCm39) I233N possibly damaging Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Ppara A G 15: 85,671,398 (GRCm39) I100V probably benign Het
Rem2 T C 14: 54,715,116 (GRCm39) S98P probably damaging Het
Rpl5-ps2 G T 2: 154,546,156 (GRCm39) noncoding transcript Het
Scmh1 T A 4: 120,385,495 (GRCm39) H623Q probably damaging Het
Scn9a A G 2: 66,313,902 (GRCm39) S1939P possibly damaging Het
Slc6a13 T C 6: 121,313,101 (GRCm39) probably null Het
Slc7a4 G A 16: 17,392,141 (GRCm39) T431I probably benign Het
Snupn A G 9: 56,885,346 (GRCm39) E217G probably benign Het
Spopl T A 2: 23,427,497 (GRCm39) K212* probably null Het
Strn T A 17: 78,984,801 (GRCm39) T281S possibly damaging Het
Supt3 T A 17: 45,352,116 (GRCm39) L265* probably null Het
Taf5l G A 8: 124,724,289 (GRCm39) T510M probably damaging Het
Tapbp C A 17: 34,145,427 (GRCm39) D415E probably damaging Het
Tarbp1 A T 8: 127,178,972 (GRCm39) D702E probably benign Het
Tfap2c C A 2: 172,399,247 (GRCm39) P473Q probably damaging Het
Tnc T C 4: 63,913,909 (GRCm39) N1301S probably damaging Het
Trim33 A G 3: 103,237,481 (GRCm39) Q179R probably damaging Het
Txnrd2 A G 16: 18,287,554 (GRCm39) N335S probably benign Het
Uggt1 T A 1: 36,189,154 (GRCm39) D1444V probably damaging Het
Ugt3a1 T C 15: 9,338,807 (GRCm39) L57P probably benign Het
Vmn2r6 A T 3: 64,467,068 (GRCm39) W144R probably benign Het
Vmn2r98 T A 17: 19,286,354 (GRCm39) M284K probably benign Het
Zfp558 A T 9: 18,367,799 (GRCm39) C330S possibly damaging Het
Zfp703 T C 8: 27,468,981 (GRCm39) V215A probably benign Het
Other mutations in Dmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Dmxl1 APN 18 49,984,534 (GRCm39) missense probably damaging 1.00
IGL00668:Dmxl1 APN 18 50,072,620 (GRCm39) missense possibly damaging 0.64
IGL00740:Dmxl1 APN 18 50,050,735 (GRCm39) missense probably benign 0.00
IGL00969:Dmxl1 APN 18 50,045,792 (GRCm39) missense probably benign 0.02
IGL01113:Dmxl1 APN 18 50,045,818 (GRCm39) missense probably benign 0.01
IGL01384:Dmxl1 APN 18 49,990,401 (GRCm39) missense probably benign
IGL01475:Dmxl1 APN 18 50,004,781 (GRCm39) missense probably damaging 1.00
IGL01559:Dmxl1 APN 18 50,054,005 (GRCm39) missense probably damaging 0.99
IGL01578:Dmxl1 APN 18 50,095,272 (GRCm39) missense probably damaging 1.00
IGL01632:Dmxl1 APN 18 49,996,092 (GRCm39) missense probably damaging 0.99
IGL01814:Dmxl1 APN 18 49,997,935 (GRCm39) missense probably damaging 1.00
IGL01843:Dmxl1 APN 18 50,011,449 (GRCm39) nonsense probably null
IGL01933:Dmxl1 APN 18 50,010,852 (GRCm39) missense probably benign 0.17
IGL01952:Dmxl1 APN 18 50,023,721 (GRCm39) missense probably benign 0.11
IGL02120:Dmxl1 APN 18 50,027,245 (GRCm39) missense possibly damaging 0.83
IGL02162:Dmxl1 APN 18 50,094,230 (GRCm39) missense probably benign 0.00
IGL02213:Dmxl1 APN 18 50,010,741 (GRCm39) splice site probably benign
IGL02261:Dmxl1 APN 18 49,973,566 (GRCm39) missense possibly damaging 0.85
IGL02689:Dmxl1 APN 18 49,997,962 (GRCm39) missense probably damaging 1.00
IGL02892:Dmxl1 APN 18 49,992,187 (GRCm39) missense probably damaging 0.96
IGL03232:Dmxl1 APN 18 50,011,247 (GRCm39) missense probably benign 0.01
IGL03258:Dmxl1 APN 18 50,053,960 (GRCm39) missense probably damaging 1.00
IGL03298:Dmxl1 APN 18 49,997,885 (GRCm39) missense probably benign
capture UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
carnivora UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
digestion UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
drowning UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
hibiscus UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
impound UTSW 18 50,026,316 (GRCm39) missense probably benign
pitcher UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
PIT4810001:Dmxl1 UTSW 18 50,065,030 (GRCm39) missense probably damaging 1.00
R0001:Dmxl1 UTSW 18 50,021,964 (GRCm39) splice site probably benign
R0027:Dmxl1 UTSW 18 50,090,362 (GRCm39) splice site probably benign
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0042:Dmxl1 UTSW 18 49,997,102 (GRCm39) missense probably benign 0.03
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0046:Dmxl1 UTSW 18 50,011,149 (GRCm39) missense probably benign 0.22
R0257:Dmxl1 UTSW 18 50,088,870 (GRCm39) splice site probably benign
R0349:Dmxl1 UTSW 18 50,012,349 (GRCm39) missense probably damaging 0.99
R0390:Dmxl1 UTSW 18 50,012,429 (GRCm39) missense probably benign 0.14
R0511:Dmxl1 UTSW 18 50,024,534 (GRCm39) nonsense probably null
R0539:Dmxl1 UTSW 18 49,990,497 (GRCm39) splice site probably benign
R0542:Dmxl1 UTSW 18 50,026,761 (GRCm39) missense probably benign 0.05
R0587:Dmxl1 UTSW 18 50,068,374 (GRCm39) missense probably benign 0.39
R0635:Dmxl1 UTSW 18 49,984,490 (GRCm39) splice site probably benign
R0744:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0836:Dmxl1 UTSW 18 49,966,215 (GRCm39) missense probably damaging 1.00
R0845:Dmxl1 UTSW 18 50,026,469 (GRCm39) missense probably damaging 1.00
R1218:Dmxl1 UTSW 18 50,026,678 (GRCm39) missense probably damaging 1.00
R1278:Dmxl1 UTSW 18 50,026,292 (GRCm39) missense probably benign
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1313:Dmxl1 UTSW 18 50,011,550 (GRCm39) missense probably damaging 1.00
R1349:Dmxl1 UTSW 18 50,021,920 (GRCm39) missense probably damaging 1.00
R1453:Dmxl1 UTSW 18 49,990,316 (GRCm39) missense probably benign 0.05
R1522:Dmxl1 UTSW 18 49,985,434 (GRCm39) missense probably benign 0.05
R1629:Dmxl1 UTSW 18 49,992,353 (GRCm39) critical splice donor site probably null
R1638:Dmxl1 UTSW 18 50,023,834 (GRCm39) nonsense probably null
R1646:Dmxl1 UTSW 18 50,095,328 (GRCm39) missense probably damaging 1.00
R1719:Dmxl1 UTSW 18 50,067,704 (GRCm39) missense probably damaging 1.00
R1732:Dmxl1 UTSW 18 50,036,055 (GRCm39) missense probably benign
R1732:Dmxl1 UTSW 18 50,026,511 (GRCm39) nonsense probably null
R1886:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1887:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R1895:Dmxl1 UTSW 18 50,088,981 (GRCm39) splice site probably null
R1911:Dmxl1 UTSW 18 50,011,230 (GRCm39) missense probably benign 0.00
R2020:Dmxl1 UTSW 18 50,022,625 (GRCm39) nonsense probably null
R2116:Dmxl1 UTSW 18 50,011,884 (GRCm39) missense probably damaging 1.00
R2196:Dmxl1 UTSW 18 50,050,698 (GRCm39) missense probably benign 0.00
R2206:Dmxl1 UTSW 18 50,027,161 (GRCm39) missense probably benign 0.12
R2216:Dmxl1 UTSW 18 50,026,990 (GRCm39) missense probably benign 0.00
R2255:Dmxl1 UTSW 18 49,979,706 (GRCm39) missense probably benign 0.34
R2333:Dmxl1 UTSW 18 50,053,043 (GRCm39) splice site probably null
R2343:Dmxl1 UTSW 18 50,023,745 (GRCm39) missense probably damaging 1.00
R2496:Dmxl1 UTSW 18 50,013,858 (GRCm39) missense possibly damaging 0.51
R3757:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3758:Dmxl1 UTSW 18 50,068,384 (GRCm39) missense probably damaging 0.98
R3783:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3786:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3787:Dmxl1 UTSW 18 49,998,189 (GRCm39) missense probably damaging 1.00
R3885:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3886:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3887:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3888:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R3889:Dmxl1 UTSW 18 50,011,326 (GRCm39) missense probably damaging 1.00
R4014:Dmxl1 UTSW 18 49,997,029 (GRCm39) missense probably benign
R4033:Dmxl1 UTSW 18 49,984,498 (GRCm39) missense possibly damaging 0.95
R4096:Dmxl1 UTSW 18 50,094,264 (GRCm39) missense probably damaging 1.00
R4366:Dmxl1 UTSW 18 50,011,084 (GRCm39) nonsense probably null
R4406:Dmxl1 UTSW 18 50,022,620 (GRCm39) missense probably damaging 1.00
R4412:Dmxl1 UTSW 18 49,981,828 (GRCm39) missense probably benign
R4454:Dmxl1 UTSW 18 50,026,399 (GRCm39) missense probably benign 0.01
R4459:Dmxl1 UTSW 18 50,094,283 (GRCm39) missense possibly damaging 0.80
R4569:Dmxl1 UTSW 18 49,985,427 (GRCm39) missense probably damaging 1.00
R4606:Dmxl1 UTSW 18 50,095,248 (GRCm39) missense probably damaging 0.98
R4649:Dmxl1 UTSW 18 50,011,698 (GRCm39) missense probably damaging 0.99
R4683:Dmxl1 UTSW 18 50,011,088 (GRCm39) missense probably damaging 1.00
R4782:Dmxl1 UTSW 18 49,996,059 (GRCm39) missense probably damaging 1.00
R4878:Dmxl1 UTSW 18 49,984,543 (GRCm39) missense probably damaging 1.00
R4879:Dmxl1 UTSW 18 50,022,534 (GRCm39) missense probably damaging 1.00
R4881:Dmxl1 UTSW 18 50,090,348 (GRCm39) intron probably benign
R4885:Dmxl1 UTSW 18 50,011,862 (GRCm39) missense probably damaging 0.99
R4916:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5022:Dmxl1 UTSW 18 50,028,194 (GRCm39) missense probably damaging 0.99
R5056:Dmxl1 UTSW 18 50,003,990 (GRCm39) missense probably benign 0.00
R5177:Dmxl1 UTSW 18 50,026,651 (GRCm39) missense probably damaging 0.99
R5342:Dmxl1 UTSW 18 50,084,302 (GRCm39) missense probably damaging 0.96
R5421:Dmxl1 UTSW 18 49,996,186 (GRCm39) critical splice donor site probably null
R5433:Dmxl1 UTSW 18 50,000,966 (GRCm39) splice site probably null
R5484:Dmxl1 UTSW 18 50,022,531 (GRCm39) missense probably damaging 1.00
R5598:Dmxl1 UTSW 18 49,997,545 (GRCm39) missense probably benign 0.04
R5633:Dmxl1 UTSW 18 50,010,764 (GRCm39) missense probably damaging 1.00
R5638:Dmxl1 UTSW 18 50,024,693 (GRCm39) missense possibly damaging 0.95
R5694:Dmxl1 UTSW 18 50,027,324 (GRCm39) missense probably damaging 1.00
R5696:Dmxl1 UTSW 18 50,065,008 (GRCm39) nonsense probably null
R5706:Dmxl1 UTSW 18 50,090,462 (GRCm39) critical splice donor site probably null
R5745:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R5876:Dmxl1 UTSW 18 50,004,051 (GRCm39) missense possibly damaging 0.70
R6054:Dmxl1 UTSW 18 49,990,453 (GRCm39) missense probably benign 0.00
R6145:Dmxl1 UTSW 18 50,045,833 (GRCm39) missense possibly damaging 0.90
R6189:Dmxl1 UTSW 18 50,026,402 (GRCm39) missense probably benign 0.33
R6213:Dmxl1 UTSW 18 49,996,082 (GRCm39) missense possibly damaging 0.93
R6219:Dmxl1 UTSW 18 50,035,434 (GRCm39) missense probably damaging 0.99
R6221:Dmxl1 UTSW 18 50,004,799 (GRCm39) missense probably damaging 0.96
R6276:Dmxl1 UTSW 18 49,979,653 (GRCm39) missense probably benign
R6319:Dmxl1 UTSW 18 49,985,367 (GRCm39) missense probably benign 0.00
R6426:Dmxl1 UTSW 18 49,997,645 (GRCm39) missense probably damaging 0.99
R6567:Dmxl1 UTSW 18 49,992,246 (GRCm39) missense probably damaging 0.99
R6739:Dmxl1 UTSW 18 50,011,313 (GRCm39) missense probably benign 0.03
R6743:Dmxl1 UTSW 18 50,013,847 (GRCm39) missense possibly damaging 0.95
R6776:Dmxl1 UTSW 18 50,027,041 (GRCm39) missense probably damaging 1.00
R6827:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6828:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6829:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6830:Dmxl1 UTSW 18 50,054,091 (GRCm39) missense probably damaging 1.00
R6833:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6834:Dmxl1 UTSW 18 50,088,890 (GRCm39) missense probably damaging 0.99
R6856:Dmxl1 UTSW 18 49,985,355 (GRCm39) nonsense probably null
R6857:Dmxl1 UTSW 18 49,997,902 (GRCm39) missense probably damaging 0.99
R6881:Dmxl1 UTSW 18 50,068,372 (GRCm39) missense probably benign 0.00
R6882:Dmxl1 UTSW 18 49,976,851 (GRCm39) critical splice acceptor site probably null
R6892:Dmxl1 UTSW 18 50,053,969 (GRCm39) missense probably damaging 0.98
R6897:Dmxl1 UTSW 18 49,996,124 (GRCm39) missense possibly damaging 0.51
R6897:Dmxl1 UTSW 18 49,984,562 (GRCm39) missense probably null 0.99
R6917:Dmxl1 UTSW 18 49,997,215 (GRCm39) missense probably damaging 1.00
R7192:Dmxl1 UTSW 18 50,088,920 (GRCm39) missense probably damaging 0.99
R7447:Dmxl1 UTSW 18 49,997,681 (GRCm39) missense probably damaging 0.99
R7460:Dmxl1 UTSW 18 50,011,679 (GRCm39) missense probably benign 0.00
R7570:Dmxl1 UTSW 18 50,027,024 (GRCm39) missense possibly damaging 0.82
R7626:Dmxl1 UTSW 18 50,035,861 (GRCm39) missense probably benign
R7629:Dmxl1 UTSW 18 49,992,337 (GRCm39) missense probably damaging 1.00
R7644:Dmxl1 UTSW 18 50,026,619 (GRCm39) missense probably benign
R7688:Dmxl1 UTSW 18 50,088,938 (GRCm39) missense probably benign 0.03
R7689:Dmxl1 UTSW 18 49,979,685 (GRCm39) missense probably benign 0.00
R7712:Dmxl1 UTSW 18 50,026,528 (GRCm39) missense probably damaging 0.99
R7808:Dmxl1 UTSW 18 50,011,382 (GRCm39) missense probably benign 0.00
R7834:Dmxl1 UTSW 18 50,054,044 (GRCm39) missense probably damaging 1.00
R7848:Dmxl1 UTSW 18 49,973,557 (GRCm39) missense possibly damaging 0.88
R7849:Dmxl1 UTSW 18 50,094,214 (GRCm39) missense probably benign 0.00
R7881:Dmxl1 UTSW 18 49,997,450 (GRCm39) missense probably damaging 0.99
R7884:Dmxl1 UTSW 18 50,026,474 (GRCm39) missense possibly damaging 0.65
R8073:Dmxl1 UTSW 18 50,011,500 (GRCm39) missense probably damaging 1.00
R8089:Dmxl1 UTSW 18 50,021,897 (GRCm39) missense probably damaging 0.99
R8266:Dmxl1 UTSW 18 49,976,878 (GRCm39) missense probably benign 0.17
R8371:Dmxl1 UTSW 18 50,031,781 (GRCm39) missense probably benign 0.08
R8402:Dmxl1 UTSW 18 50,011,409 (GRCm39) missense probably benign
R8402:Dmxl1 UTSW 18 50,011,393 (GRCm39) nonsense probably null
R8402:Dmxl1 UTSW 18 50,011,394 (GRCm39) missense probably benign 0.09
R8423:Dmxl1 UTSW 18 49,998,183 (GRCm39) missense probably damaging 1.00
R8678:Dmxl1 UTSW 18 50,004,759 (GRCm39) nonsense probably null
R8702:Dmxl1 UTSW 18 49,992,202 (GRCm39) missense probably benign 0.09
R8749:Dmxl1 UTSW 18 50,088,937 (GRCm39) missense probably damaging 1.00
R8813:Dmxl1 UTSW 18 50,090,406 (GRCm39) missense probably damaging 0.99
R8877:Dmxl1 UTSW 18 50,011,292 (GRCm39) missense possibly damaging 0.55
R8945:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 50,026,741 (GRCm39) missense probably damaging 1.00
R8971:Dmxl1 UTSW 18 49,997,575 (GRCm39) missense possibly damaging 0.96
R8978:Dmxl1 UTSW 18 50,055,679 (GRCm39) missense probably benign 0.37
R8987:Dmxl1 UTSW 18 50,026,919 (GRCm39) missense
R9011:Dmxl1 UTSW 18 49,997,240 (GRCm39) missense probably damaging 1.00
R9124:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9131:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9132:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9156:Dmxl1 UTSW 18 50,072,639 (GRCm39) missense probably damaging 1.00
R9165:Dmxl1 UTSW 18 50,011,992 (GRCm39) missense probably damaging 1.00
R9244:Dmxl1 UTSW 18 50,026,316 (GRCm39) missense probably benign
R9254:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9262:Dmxl1 UTSW 18 49,976,919 (GRCm39) missense probably benign 0.03
R9335:Dmxl1 UTSW 18 49,992,187 (GRCm39) missense probably damaging 0.96
R9375:Dmxl1 UTSW 18 50,091,477 (GRCm39) missense probably damaging 1.00
R9379:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.67
R9434:Dmxl1 UTSW 18 50,010,788 (GRCm39) missense probably damaging 0.98
R9470:Dmxl1 UTSW 18 50,026,777 (GRCm39) missense possibly damaging 0.69
R9500:Dmxl1 UTSW 18 50,011,271 (GRCm39) missense probably damaging 1.00
R9507:Dmxl1 UTSW 18 50,024,567 (GRCm39) missense possibly damaging 0.94
R9617:Dmxl1 UTSW 18 49,998,228 (GRCm39) missense probably damaging 1.00
R9642:Dmxl1 UTSW 18 50,013,825 (GRCm39) missense probably damaging 1.00
RF009:Dmxl1 UTSW 18 50,026,461 (GRCm39) missense probably damaging 0.96
X0025:Dmxl1 UTSW 18 49,997,435 (GRCm39) missense probably damaging 0.98
X0066:Dmxl1 UTSW 18 50,052,966 (GRCm39) missense probably damaging 1.00
Z1088:Dmxl1 UTSW 18 50,054,032 (GRCm39) missense probably benign
Z1188:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Z1189:Dmxl1 UTSW 18 50,001,070 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGACTTACGAGAGAATAAAACCCC -3'
(R):5'- ACAGTTCAAGTTGGTGACGC -3'

Sequencing Primer
(F):5'- AAAACCCCTTAATTTTCCTTTTTCTG -3'
(R):5'- AAGTTGGTGACGCTCTCTAACAC -3'
Posted On 2015-09-24