Incidental Mutation 'R4571:Edn3'
ID342125
Institutional Source Beutler Lab
Gene Symbol Edn3
Ensembl Gene ENSMUSG00000027524
Gene Nameendothelin 3
Synonyms114CH19, 114-CH19, tmgc48
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174760619-174784042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 174781904 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 211 (A211T)
Ref Sequence ENSEMBL: ENSMUSP00000029030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029030] [ENSMUST00000140908]
Predicted Effect probably benign
Transcript: ENSMUST00000029030
AA Change: A211T

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029030
Gene: ENSMUSG00000027524
AA Change: A211T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
END 96 117 6.7e-6 SMART
END 158 179 1.53e-9 SMART
low complexity region 185 196 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137369
Predicted Effect probably benign
Transcript: ENSMUST00000140908
AA Change: A163T

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000125602
Gene: ENSMUSG00000027524
AA Change: A163T

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
END 52 73 6.7e-6 SMART
END 114 135 1.53e-9 SMART
low complexity region 137 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162473
Meta Mutation Damage Score 0.0815 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene is a member of the endothelin family whose members encode proteins that act on G protein-coupled receptors. Endothelins are produced as large prepropolypeptide precursors that undergo a first cleavage by a subtilisin serine protease to form an inactive intermediate, which in turn is cleaved again by endothelin-converting enzyme 1 (ECE-1) to yield the active 21 amino acid peptide. This gene encodes a protein which is expressed in neural crest cells (NCC), binds to endothelin receptor b (Ednrb) and plays an essential role in the development of NCC-derived cell lineages including melanocytes and enteric neurons. Mutations in this gene are associated with terminal aganglionosis and white spotted coat in mice and Hirschsprung's disease and Waardenburg syndrome in humans. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for mutations at this locus exhibit aganglionic megacolon with white spotting of the hair coat due to impaired expansion and differentiation of epidermal melanoblasts. Mutants die around weaning with impacted colons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Edn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0410:Edn3 UTSW 2 174761689 missense possibly damaging 0.58
R0540:Edn3 UTSW 2 174760974 missense probably damaging 1.00
R1900:Edn3 UTSW 2 174761605 missense possibly damaging 0.48
R2017:Edn3 UTSW 2 174778662 missense probably benign 0.00
R4891:Edn3 UTSW 2 174761732 missense probably benign 0.11
R5218:Edn3 UTSW 2 174761552 missense probably benign 0.09
R6008:Edn3 UTSW 2 174779732 missense probably benign 0.00
R7447:Edn3 UTSW 2 174761751 nonsense probably null
R7500:Edn3 UTSW 2 174779535 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCAAAGAGTGAGCCAACTGC -3'
(R):5'- GCCAATTCCCAACTTGTCGC -3'

Sequencing Primer
(F):5'- AACTGCAGGCCTTCTGGTG -3'
(R):5'- TCCCAACTTGTCGCTAAAGAGGTG -3'
Posted On2015-09-24