Incidental Mutation 'R4571:Trpv6'
ID342135
Institutional Source Beutler Lab
Gene Symbol Trpv6
Ensembl Gene ENSMUSG00000029868
Gene Nametransient receptor potential cation channel, subfamily V, member 6
SynonymsCAT, Ecac2, CaT1, Cac
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41620624-41636405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41621744 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 649 (R649H)
Ref Sequence ENSEMBL: ENSMUSP00000143854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]
Predicted Effect probably damaging
Transcript: ENSMUST00000031902
AA Change: R649H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868
AA Change: R649H

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114732
SMART Domains Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
EPH_lbd 34 227 2.18e-100 SMART
low complexity region 242 255 N/A INTRINSIC
Pfam:GCC2_GCC3 299 341 1.9e-9 PFAM
FN3 365 462 3.59e-3 SMART
FN3 481 562 3.73e-10 SMART
Pfam:EphA2_TM 589 660 3.4e-16 PFAM
Pfam:Pkinase 663 908 1.4e-29 PFAM
Pfam:Pkinase_Tyr 663 908 1.1e-67 PFAM
SAM 938 1005 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167082
Predicted Effect probably benign
Transcript: ENSMUST00000167497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194405
Predicted Effect probably damaging
Transcript: ENSMUST00000201471
AA Change: R649H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868
AA Change: R649H

DomainStartEndE-ValueType
ANK 44 74 2.39e2 SMART
ANK 78 107 6.17e-1 SMART
ANK 116 145 3.06e-5 SMART
ANK 162 191 1.85e-4 SMART
Blast:ANK 195 223 3e-10 BLAST
ANK 238 267 2.47e2 SMART
Pfam:Ion_trans 327 589 9.8e-18 PFAM
low complexity region 680 695 N/A INTRINSIC
Meta Mutation Damage Score 0.2839 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of multipass membrane proteins that functions as calcium channels. The encoded protein contains N-terminal ankyrin repeats, which are required for channel assembly and regulation. Translation initiation for this protein occurs at a non-AUG start codon that is decoded as methionine. This gene is situated next to a closely related gene for transient receptor potential cation channel subfamily V member 5 (TRPV5). This locus has experienced positive selection in non-African populations, resulting in several non-synonymous codon differences among individuals of different genetic backgrounds. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired sperm motility and decreased fertilization by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Trpv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Trpv6 APN 6 41626867 splice site probably benign
IGL02033:Trpv6 APN 6 41627617 splice site probably benign
IGL02439:Trpv6 APN 6 41625487 missense probably damaging 1.00
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0973:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R0974:Trpv6 UTSW 6 41625188 missense probably benign 0.01
R1385:Trpv6 UTSW 6 41621129 missense probably benign 0.32
R1696:Trpv6 UTSW 6 41621768 missense possibly damaging 0.95
R2095:Trpv6 UTSW 6 41621756 missense probably damaging 0.99
R2287:Trpv6 UTSW 6 41626111 missense probably damaging 1.00
R2298:Trpv6 UTSW 6 41636076 missense possibly damaging 0.62
R2519:Trpv6 UTSW 6 41624616 nonsense probably null
R3522:Trpv6 UTSW 6 41627405 missense probably damaging 0.99
R4172:Trpv6 UTSW 6 41625498 missense probably damaging 1.00
R4397:Trpv6 UTSW 6 41625238 missense possibly damaging 0.82
R4568:Trpv6 UTSW 6 41626569 missense probably damaging 1.00
R5547:Trpv6 UTSW 6 41636154 missense possibly damaging 0.68
R6344:Trpv6 UTSW 6 41625422 splice site probably null
R6989:Trpv6 UTSW 6 41625456 missense probably damaging 1.00
R7427:Trpv6 UTSW 6 41625153 missense probably benign
R7445:Trpv6 UTSW 6 41621342 missense probably damaging 1.00
R7538:Trpv6 UTSW 6 41626167 missense probably benign 0.01
R7960:Trpv6 UTSW 6 41627678 missense probably benign 0.00
R8059:Trpv6 UTSW 6 41624586 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGATGCTTAGGGGCCCAAG -3'
(R):5'- GGCTTGTTTCCATTTCTAGAAAGCC -3'

Sequencing Primer
(F):5'- AGCTCAAAACTGAGTCTTGTCC -3'
(R):5'- AGCCACAAGTCCCTGAGTTTC -3'
Posted On2015-09-24