Incidental Mutation 'R4571:Apbb1'
ID342141
Institutional Source Beutler Lab
Gene Symbol Apbb1
Ensembl Gene ENSMUSG00000037032
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1
SynonymsFe65, Rir
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105558483-105581653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105573762 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 214 (N214I)
Ref Sequence ENSEMBL: ENSMUSP00000140116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081165] [ENSMUST00000186868] [ENSMUST00000187051] [ENSMUST00000187057] [ENSMUST00000187683] [ENSMUST00000187721] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000188440] [ENSMUST00000188726] [ENSMUST00000189072] [ENSMUST00000189378] [ENSMUST00000191011] [ENSMUST00000191601] [ENSMUST00000210079] [ENSMUST00000189265] [ENSMUST00000190369]
Predicted Effect probably damaging
Transcript: ENSMUST00000081165
AA Change: N214I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032
AA Change: N214I

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186868
SMART Domains Protein: ENSMUSP00000140052
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187051
SMART Domains Protein: ENSMUSP00000139755
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 1.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
SCOP:d1shca_ 74 120 9e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187057
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187683
SMART Domains Protein: ENSMUSP00000139426
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 2.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Pfam:PID 111 158 5.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187721
SMART Domains Protein: ENSMUSP00000140192
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
WW 54 85 3.7e-7 SMART
low complexity region 87 99 N/A INTRINSIC
Pfam:PID 170 242 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably benign
Transcript: ENSMUST00000188368
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188440
SMART Domains Protein: ENSMUSP00000140715
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 3.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 223 1.4e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188726
Predicted Effect probably benign
Transcript: ENSMUST00000189072
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189378
AA Change: N214I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032
AA Change: N214I

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191011
AA Change: N214I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032
AA Change: N214I

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191601
AA Change: N214I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032
AA Change: N214I

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210079
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Meta Mutation Damage Score 0.4805 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a null allele are hypersensitive to ionizing radiation while mouse embryonic fibroblasts are hypersensitive to DNA damaging agents. Homozygotes for a second null allele display impaired performance in learning and memory tasks, with a striking deficit in reversal spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Apbb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Apbb1 APN 7 105559126 splice site probably benign
athena UTSW 7 105566695 missense probably benign
R0092:Apbb1 UTSW 7 105559154 missense probably damaging 1.00
R0348:Apbb1 UTSW 7 105565303 missense probably damaging 0.98
R0633:Apbb1 UTSW 7 105558963 missense probably damaging 1.00
R0946:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1076:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1332:Apbb1 UTSW 7 105565543 missense possibly damaging 0.74
R1658:Apbb1 UTSW 7 105574084 missense probably damaging 1.00
R1739:Apbb1 UTSW 7 105574227 missense probably benign
R4230:Apbb1 UTSW 7 105567684 missense probably damaging 1.00
R4296:Apbb1 UTSW 7 105573826 missense probably benign 0.16
R4385:Apbb1 UTSW 7 105567276 missense probably benign 0.00
R4647:Apbb1 UTSW 7 105565538 missense probably benign 0.01
R4812:Apbb1 UTSW 7 105574025 missense probably damaging 0.99
R5044:Apbb1 UTSW 7 105565682 intron probably benign
R5109:Apbb1 UTSW 7 105565035 missense probably damaging 1.00
R5479:Apbb1 UTSW 7 105565025 missense probably damaging 0.97
R5611:Apbb1 UTSW 7 105559483 missense probably damaging 1.00
R5677:Apbb1 UTSW 7 105559246 missense probably damaging 1.00
R5785:Apbb1 UTSW 7 105567715 missense probably damaging 1.00
R5850:Apbb1 UTSW 7 105567583 missense probably damaging 1.00
R5896:Apbb1 UTSW 7 105574225 missense probably damaging 1.00
R6151:Apbb1 UTSW 7 105574252 nonsense probably null
R6186:Apbb1 UTSW 7 105567726 missense probably damaging 1.00
R6229:Apbb1 UTSW 7 105573730 missense probably damaging 0.98
R6229:Apbb1 UTSW 7 105573731 missense probably damaging 0.98
R6288:Apbb1 UTSW 7 105559227 missense probably damaging 1.00
R6295:Apbb1 UTSW 7 105566695 missense probably benign
R6443:Apbb1 UTSW 7 105573763 missense probably damaging 1.00
R6729:Apbb1 UTSW 7 105565381 missense probably damaging 1.00
R7130:Apbb1 UTSW 7 105565331 missense probably damaging 0.98
R7209:Apbb1 UTSW 7 105566085 missense probably damaging 1.00
R7467:Apbb1 UTSW 7 105566132 missense probably benign 0.04
R7489:Apbb1 UTSW 7 105567480 missense probably benign 0.30
R7588:Apbb1 UTSW 7 105573966 missense probably benign 0.29
R7754:Apbb1 UTSW 7 105559302 missense probably damaging 0.97
R7768:Apbb1 UTSW 7 105567088 missense probably benign
R7785:Apbb1 UTSW 7 105567423 missense probably benign 0.00
R7804:Apbb1 UTSW 7 105566600 missense probably damaging 1.00
R7809:Apbb1 UTSW 7 105573807 missense probably benign 0.04
R7995:Apbb1 UTSW 7 105565645 missense probably benign 0.09
Z1088:Apbb1 UTSW 7 105559136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATAGGCTCTGCAGCTCATG -3'
(R):5'- GATCCGCCTTGATCATCAACAC -3'

Sequencing Primer
(F):5'- TCATGCTCAGGCTGGCCTTG -3'
(R):5'- GCCTTGATCATCAACACCCAGG -3'
Posted On2015-09-24