Incidental Mutation 'R4571:Clasp2'
ID342145
Institutional Source Beutler Lab
Gene Symbol Clasp2
Ensembl Gene ENSMUSG00000033392
Gene NameCLIP associating protein 2
Synonyms1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location113741473-113919682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113847721 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 173 (L173F)
Ref Sequence ENSEMBL: ENSMUSP00000130201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111838] [ENSMUST00000163895] [ENSMUST00000166734] [ENSMUST00000213663] [ENSMUST00000214522] [ENSMUST00000215022] [ENSMUST00000216817]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111838
AA Change: L173F

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107469
Gene: ENSMUSG00000033392
AA Change: L173F

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 877 2.03e-1 SMART
low complexity region 995 1009 N/A INTRINSIC
TOG 1043 1274 1.49e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163895
AA Change: L173F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128460
Gene: ENSMUSG00000033392
AA Change: L173F

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 583 593 N/A INTRINSIC
low complexity region 635 655 N/A INTRINSIC
TOG 661 898 2.03e-1 SMART
low complexity region 1016 1030 N/A INTRINSIC
TOG 1064 1295 1.49e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166734
AA Change: L173F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130201
Gene: ENSMUSG00000033392
AA Change: L173F

DomainStartEndE-ValueType
TOG 90 323 1.17e-8 SMART
low complexity region 382 395 N/A INTRINSIC
low complexity region 459 472 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 562 572 N/A INTRINSIC
low complexity region 614 634 N/A INTRINSIC
TOG 640 878 7.51e-1 SMART
low complexity region 996 1010 N/A INTRINSIC
TOG 1044 1275 1.49e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213966
Predicted Effect probably damaging
Transcript: ENSMUST00000214522
AA Change: L173F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214860
Predicted Effect probably benign
Transcript: ENSMUST00000215022
Predicted Effect probably benign
Transcript: ENSMUST00000216817
Meta Mutation Damage Score 0.3115 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Targeted deletion of this gene leads to impaired formation of stable microtubules in a wound healing assay, and results in a 2-fold reduction of directionally persistent migration in mutant embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Clasp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Clasp2 APN 9 113905992 splice site probably benign
IGL00885:Clasp2 APN 9 113911416 missense probably damaging 1.00
IGL01314:Clasp2 APN 9 113906127 missense possibly damaging 0.89
IGL01344:Clasp2 APN 9 113813292 splice site probably null
IGL01567:Clasp2 APN 9 113880096 missense probably damaging 1.00
IGL02238:Clasp2 APN 9 113880020 missense probably damaging 1.00
IGL02299:Clasp2 APN 9 113879989 missense probably damaging 1.00
IGL02323:Clasp2 APN 9 113868726 splice site probably benign
IGL02635:Clasp2 APN 9 113908842 missense probably damaging 0.98
IGL02645:Clasp2 APN 9 113890061 missense probably damaging 1.00
IGL02976:Clasp2 APN 9 113906136 missense probably damaging 1.00
IGL03190:Clasp2 APN 9 113844140 nonsense probably null
IGL03219:Clasp2 APN 9 113848477 splice site probably benign
PIT4810001:Clasp2 UTSW 9 113906067 missense probably damaging 1.00
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0067:Clasp2 UTSW 9 113860141 splice site probably benign
R0421:Clasp2 UTSW 9 113854302 missense probably benign 0.02
R0432:Clasp2 UTSW 9 113909419 missense probably benign 0.00
R0458:Clasp2 UTSW 9 113906224 splice site probably null
R0865:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R0972:Clasp2 UTSW 9 113847705 missense possibly damaging 0.58
R1037:Clasp2 UTSW 9 113896634 splice site probably benign
R1925:Clasp2 UTSW 9 113906197 missense possibly damaging 0.88
R2015:Clasp2 UTSW 9 113911500 missense possibly damaging 0.57
R2066:Clasp2 UTSW 9 113906157 missense possibly damaging 0.86
R2330:Clasp2 UTSW 9 113876304 missense probably damaging 1.00
R2568:Clasp2 UTSW 9 113878764 missense probably benign
R3011:Clasp2 UTSW 9 113901513 missense probably damaging 1.00
R3879:Clasp2 UTSW 9 113889961 missense probably damaging 0.98
R3915:Clasp2 UTSW 9 113908737 missense probably damaging 0.99
R3928:Clasp2 UTSW 9 113906105 missense probably benign 0.28
R4323:Clasp2 UTSW 9 113889959 missense possibly damaging 0.91
R4975:Clasp2 UTSW 9 113903916 missense probably damaging 1.00
R5445:Clasp2 UTSW 9 113903946 missense probably damaging 1.00
R5564:Clasp2 UTSW 9 113812768 critical splice donor site probably null
R5697:Clasp2 UTSW 9 113860122 missense probably benign 0.01
R5780:Clasp2 UTSW 9 113850152 missense probably damaging 0.99
R5787:Clasp2 UTSW 9 113862242 missense probably damaging 1.00
R6011:Clasp2 UTSW 9 113876247 missense probably benign 0.07
R6026:Clasp2 UTSW 9 113911578 missense probably benign 0.13
R6090:Clasp2 UTSW 9 113852735 missense probably benign 0.06
R6262:Clasp2 UTSW 9 113876352 critical splice donor site probably null
R6427:Clasp2 UTSW 9 113892444 missense probably damaging 1.00
R6464:Clasp2 UTSW 9 113773717 missense probably damaging 1.00
R6586:Clasp2 UTSW 9 113813264 missense probably damaging 1.00
R6628:Clasp2 UTSW 9 113896720 missense probably damaging 1.00
R6745:Clasp2 UTSW 9 113875270 nonsense probably null
R7032:Clasp2 UTSW 9 113854323 missense probably benign 0.04
R7165:Clasp2 UTSW 9 113786399 splice site probably null
R7221:Clasp2 UTSW 9 113852757 missense probably damaging 0.99
R7336:Clasp2 UTSW 9 113876353 splice site probably null
R7583:Clasp2 UTSW 9 113908687 missense probably benign 0.02
R7774:Clasp2 UTSW 9 113848736 splice site probably null
R7895:Clasp2 UTSW 9 113903948 missense probably benign 0.03
R8084:Clasp2 UTSW 9 113847755 missense probably benign 0.16
R8109:Clasp2 UTSW 9 113911520 missense probably damaging 1.00
R8171:Clasp2 UTSW 9 113903906 missense possibly damaging 0.88
R8230:Clasp2 UTSW 9 113892414 missense possibly damaging 0.73
X0022:Clasp2 UTSW 9 113852672 missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113770221 missense probably damaging 1.00
Z1177:Clasp2 UTSW 9 113908795 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTGCCTGTTATTAGATAGGGAAGAAG -3'
(R):5'- TTCCTTTAGAGGCAACAACAAC -3'

Sequencing Primer
(F):5'- ATGGCTAAAACCCTGCCTGG -3'
(R):5'- GAGGCAACAACAACAACAATAATATG -3'
Posted On2015-09-24