Incidental Mutation 'R4571:Brca1'
ID342152
Institutional Source Beutler Lab
Gene Symbol Brca1
Ensembl Gene ENSMUSG00000017146
Gene Namebreast cancer 1, early onset
Synonyms
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101488764-101551955 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101517366 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1377 (R1377L)
Ref Sequence ENSEMBL: ENSMUSP00000017290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017290]
Predicted Effect probably benign
Transcript: ENSMUST00000017290
AA Change: R1377L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: R1377L

DomainStartEndE-ValueType
RING 24 64 1.82e-7 SMART
Pfam:BRCT_assoc 342 503 2.6e-69 PFAM
low complexity region 1173 1185 N/A INTRINSIC
Blast:BRCT 1343 1406 2e-16 BLAST
low complexity region 1555 1575 N/A INTRINSIC
BRCT 1587 1669 3.87e-11 SMART
BRCT 1700 1787 3.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131460
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Brca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Brca1 APN 11 101524369 missense possibly damaging 0.71
IGL01598:Brca1 APN 11 101524330 missense probably benign 0.04
IGL01744:Brca1 APN 11 101524176 missense possibly damaging 0.73
IGL02128:Brca1 APN 11 101530982 unclassified probably benign
IGL02377:Brca1 APN 11 101524323 missense probably benign 0.01
IGL02701:Brca1 APN 11 101525235 missense probably damaging 1.00
IGL02732:Brca1 APN 11 101492219 missense probably benign 0.07
IGL02935:Brca1 APN 11 101489867 missense probably benign 0.00
IGL02940:Brca1 APN 11 101489912 missense probably benign 0.00
IGL03198:Brca1 APN 11 101512711 splice site probably benign
PIT4142001:Brca1 UTSW 11 101522422 unclassified probably benign
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0048:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0109:Brca1 UTSW 11 101531090 missense possibly damaging 0.85
R0144:Brca1 UTSW 11 101526121 missense probably damaging 1.00
R0336:Brca1 UTSW 11 101523993 missense probably benign 0.04
R0448:Brca1 UTSW 11 101508221 missense possibly damaging 0.93
R0595:Brca1 UTSW 11 101524887 missense probably benign 0.27
R0613:Brca1 UTSW 11 101508210 missense probably benign 0.18
R0863:Brca1 UTSW 11 101524770 missense probably benign 0.36
R0940:Brca1 UTSW 11 101532143 missense possibly damaging 0.73
R0962:Brca1 UTSW 11 101525366 missense possibly damaging 0.46
R1365:Brca1 UTSW 11 101501996 missense probably benign
R1391:Brca1 UTSW 11 101526546 missense possibly damaging 0.53
R1467:Brca1 UTSW 11 101531107 unclassified probably benign
R1484:Brca1 UTSW 11 101529812 missense possibly damaging 0.86
R1530:Brca1 UTSW 11 101524695 missense probably damaging 1.00
R1645:Brca1 UTSW 11 101510053 missense probably benign 0.00
R1682:Brca1 UTSW 11 101525565 missense probably damaging 0.98
R1687:Brca1 UTSW 11 101489840 missense probably benign
R1694:Brca1 UTSW 11 101532099 missense probably damaging 0.98
R1695:Brca1 UTSW 11 101524455 missense probably damaging 0.97
R1762:Brca1 UTSW 11 101532018 critical splice donor site probably null
R1868:Brca1 UTSW 11 101498013 missense probably benign
R1973:Brca1 UTSW 11 101526403 missense probably benign 0.22
R2034:Brca1 UTSW 11 101489849 missense probably benign
R2106:Brca1 UTSW 11 101524977 missense possibly damaging 0.94
R4089:Brca1 UTSW 11 101524176 missense possibly damaging 0.73
R4194:Brca1 UTSW 11 101525287 missense probably benign 0.02
R4735:Brca1 UTSW 11 101492175 splice site probably null
R4789:Brca1 UTSW 11 101523932 missense probably benign 0.00
R4920:Brca1 UTSW 11 101524959 missense probably damaging 1.00
R4939:Brca1 UTSW 11 101508050 missense probably benign
R4997:Brca1 UTSW 11 101524333 missense probably damaging 0.96
R5458:Brca1 UTSW 11 101517285 missense possibly damaging 0.53
R5778:Brca1 UTSW 11 101525301 missense possibly damaging 0.47
R6051:Brca1 UTSW 11 101524246 missense probably damaging 1.00
R6505:Brca1 UTSW 11 101523541 missense probably benign 0.03
R6548:Brca1 UTSW 11 101524765 missense probably damaging 1.00
R6971:Brca1 UTSW 11 101534005 missense probably benign 0.18
R7091:Brca1 UTSW 11 101526427 missense probably benign 0.00
R7246:Brca1 UTSW 11 101523378 missense probably benign 0.00
R7417:Brca1 UTSW 11 101524981 missense probably damaging 1.00
R7861:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R7944:Brca1 UTSW 11 101526422 missense possibly damaging 0.87
R8003:Brca1 UTSW 11 101524477 missense probably benign 0.22
R8046:Brca1 UTSW 11 101525470 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCACTCTTCGAAGGAAACAGAGG -3'
(R):5'- TTGGATTAAAGGGTATTCAGCCAG -3'

Sequencing Primer
(F):5'- CTTCGAAGGAAACAGAGGGTCGAG -3'
(R):5'- TAAAGGGTATTCAGCCAGAACTC -3'
Posted On2015-09-24