Mutagenetix > Incidental Mutations

Incidental Mutation 'R4571:Brca1'

342152

Institutional Source

Beutler Lab

Gene Symbol

Brca1

Ensembl Gene

ENSMUSG00000017146

Gene Name

breast cancer 1, early onset

Synonyms

MMRRC Submission

041795-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4571 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101488764-101551955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 101517366 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 1377 (R1377L)

Ref Sequence

ENSEMBL: ENSMUSP00000017290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017290]

Predicted Effect

probably benign
Transcript: ENSMUST00000017290
AA Change: R1377L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000017290
Gene: ENSMUSG00000017146
AA Change: R1377L

Domain	Start	End	E-Value	Type
RING	24	64	1.82e-7	SMART
Pfam:BRCT_assoc	342	503	2.6e-69	PFAM
low complexity region	1173	1185	N/A	INTRINSIC
Blast:BRCT	1343	1406	2e-16	BLAST
low complexity region	1555	1575	N/A	INTRINSIC
BRCT	1587	1669	3.87e-11	SMART
BRCT	1700	1787	3.42e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131460

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA1 protein survive, have a kinky tail, pigmentation anomalies, male infertility and increased tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	A	6: 96,164,881	N394I	probably damaging	Het
Abca8a	A	T	11: 110,030,058	C1497S	probably damaging	Het
Acoxl	G	T	2: 127,877,807	G163W	probably damaging	Het
Apbb1	T	A	7: 105,573,762	N214I	probably damaging	Het
Apol7b	T	C	15: 77,423,534	K254E	probably benign	Het
Arl4d	T	A	11: 101,667,143	V165E	possibly damaging	Het
Btf3	A	G	13: 98,313,284	F65L	probably benign	Het
C2	T	C	17: 34,863,659	N495D	probably benign	Het
Cacna1c	T	C	6: 118,630,380	T1188A	probably benign	Het
Chd7	C	A	4: 8,866,217	D796E	probably benign	Het
Clasp2	G	T	9: 113,847,721	L173F	probably damaging	Het
Clec4g	A	T	8: 3,718,766		probably null	Het
Col9a3	T	C	2: 180,616,366		probably benign	Het
Csmd2	T	A	4: 128,480,095		probably null	Het
Ddx11	T	C	17: 66,130,773	C165R	probably benign	Het
Dnah7c	A	C	1: 46,533,216	M950L	probably damaging	Het
Dusp23	A	C	1: 172,632,614		probably null	Het
Ebag9	A	T	15: 44,636,762		probably null	Het
Edn3	G	A	2: 174,781,904	A211T	probably benign	Het
Eif3e	G	A	15: 43,266,162	T190I	possibly damaging	Het
Fam76a	T	C	4: 132,920,897	H3R	possibly damaging	Het
Gabbr1	G	T	17: 37,054,236	E138*	probably null	Het
Galc	T	C	12: 98,222,617	T412A	probably benign	Het
Gimap3	T	C	6: 48,765,720	D92G	possibly damaging	Het
Gin1	T	C	1: 97,785,076	Y285H	probably damaging	Het
Gm4868	A	G	5: 125,848,718		noncoding transcript	Het
Gm7052	T	A	17: 22,040,424		probably benign	Het
Gpcpd1	T	A	2: 132,550,350	E226D	probably benign	Het
Hoxb4	T	C	11: 96,319,166	S133P	possibly damaging	Het
Hrg	C	T	16: 22,961,222		probably benign	Het
Insrr	A	G	3: 87,800,887	K212R	probably benign	Het
Ipp	A	G	4: 116,530,458	D411G	probably damaging	Het
Kcnd3	C	T	3: 105,658,766	A421V	probably damaging	Het
Kcnq3	A	G	15: 66,030,612	F172L	probably damaging	Het
Kdm5d	T	C	Y: 927,110	F616S	probably damaging	Het
Lars	T	C	18: 42,228,230		probably null	Het
Lmo7	G	T	14: 101,887,594	Q496H	probably damaging	Het
Map3k9	C	A	12: 81,734,091	A432S	probably benign	Het
Nop2	T	G	6: 125,140,881		probably null	Het
Olfr1029	A	T	2: 85,975,831	E196V	probably damaging	Het
Olfr1115	C	A	2: 87,252,458	Q174K	possibly damaging	Het
Olfr420	A	T	1: 174,158,928	N52Y	possibly damaging	Het
Olfr90	T	C	17: 37,085,579	I195M	probably damaging	Het
Pan2	A	G	10: 128,308,643	T187A	probably benign	Het
Pcmtd2	A	G	2: 181,842,424	E9G	possibly damaging	Het
Pik3cb	T	A	9: 99,090,257	I283F	possibly damaging	Het
Pkhd1	G	A	1: 20,613,409	T40I	probably damaging	Het
Plxna2	T	C	1: 194,810,988	V1857A	possibly damaging	Het
Polg	T	C	7: 79,460,379	S334G	probably damaging	Het
Rem2	T	C	14: 54,477,659	S98P	probably damaging	Het
Rpl5-ps2	G	T	2: 154,704,236		noncoding transcript	Het
Slc6a18	A	T	13: 73,666,370	N468K	possibly damaging	Het
Slco4a1	A	T	2: 180,464,378	T118S	probably benign	Het
Smg1	A	T	7: 118,139,465	N3520K	possibly damaging	Het
Tapbp	C	A	17: 33,926,453	D415E	probably damaging	Het
Topaz1	A	G	9: 122,747,436	T31A	probably benign	Het
Trpv6	C	T	6: 41,621,744	R649H	probably damaging	Het
Vmn1r188	A	G	13: 22,088,518	Y214C	probably benign	Het
Vps8	T	A	16: 21,435,775	I59N	probably damaging	Het
Wnt9a	T	C	11: 59,331,337	C354R	probably damaging	Het
Zcchc2	A	G	1: 106,031,257	T1153A	possibly damaging	Het
Zfp30	A	G	7: 29,793,202	R294G	probably damaging	Het
Zfp558	A	T	9: 18,456,503	C330S	possibly damaging	Het
Zfp62	A	C	11: 49,215,741	S220R	probably damaging	Het
Zfp62	G	T	11: 49,215,742	S220I	probably damaging	Het
Zp3r	A	G	1: 130,578,020	S423P	probably damaging	Het

Other mutations in Brca1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01095:Brca1	APN	11	101524369	missense	possibly damaging	0.71
IGL01598:Brca1	APN	11	101524330	missense	probably benign	0.04
IGL01744:Brca1	APN	11	101524176	missense	possibly damaging	0.73
IGL02128:Brca1	APN	11	101530982	unclassified	probably benign
IGL02377:Brca1	APN	11	101524323	missense	probably benign	0.01
IGL02701:Brca1	APN	11	101525235	missense	probably damaging	1.00
IGL02732:Brca1	APN	11	101492219	missense	probably benign	0.07
IGL02935:Brca1	APN	11	101489867	missense	probably benign	0.00
IGL02940:Brca1	APN	11	101489912	missense	probably benign	0.00
IGL03198:Brca1	APN	11	101512711	splice site	probably benign
BB002:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB009:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
BB012:Brca1	UTSW	11	101508146	missense	probably benign	0.01
BB019:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
PIT4142001:Brca1	UTSW	11	101522422	unclassified	probably benign
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0048:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0109:Brca1	UTSW	11	101531090	missense	possibly damaging	0.85
R0144:Brca1	UTSW	11	101526121	missense	probably damaging	1.00
R0336:Brca1	UTSW	11	101523993	missense	probably benign	0.04
R0448:Brca1	UTSW	11	101508221	missense	possibly damaging	0.93
R0595:Brca1	UTSW	11	101524887	missense	probably benign	0.27
R0613:Brca1	UTSW	11	101508210	missense	probably benign	0.18
R0863:Brca1	UTSW	11	101524770	missense	probably benign	0.36
R0940:Brca1	UTSW	11	101532143	missense	possibly damaging	0.73
R0962:Brca1	UTSW	11	101525366	missense	possibly damaging	0.46
R1365:Brca1	UTSW	11	101501996	missense	probably benign
R1391:Brca1	UTSW	11	101526546	missense	possibly damaging	0.53
R1467:Brca1	UTSW	11	101531107	unclassified	probably benign
R1484:Brca1	UTSW	11	101529812	missense	possibly damaging	0.86
R1530:Brca1	UTSW	11	101524695	missense	probably damaging	1.00
R1645:Brca1	UTSW	11	101510053	missense	probably benign	0.00
R1682:Brca1	UTSW	11	101525565	missense	probably damaging	0.98
R1687:Brca1	UTSW	11	101489840	missense	probably benign
R1694:Brca1	UTSW	11	101532099	missense	probably damaging	0.98
R1695:Brca1	UTSW	11	101524455	missense	probably damaging	0.97
R1762:Brca1	UTSW	11	101532018	critical splice donor site	probably null
R1868:Brca1	UTSW	11	101498013	missense	probably benign
R1973:Brca1	UTSW	11	101526403	missense	probably benign	0.22
R2034:Brca1	UTSW	11	101489849	missense	probably benign
R2106:Brca1	UTSW	11	101524977	missense	possibly damaging	0.94
R4089:Brca1	UTSW	11	101524176	missense	possibly damaging	0.73
R4194:Brca1	UTSW	11	101525287	missense	probably benign	0.02
R4735:Brca1	UTSW	11	101492175	splice site	probably null
R4789:Brca1	UTSW	11	101523932	missense	probably benign	0.00
R4920:Brca1	UTSW	11	101524959	missense	probably damaging	1.00
R4939:Brca1	UTSW	11	101508050	missense	probably benign
R4997:Brca1	UTSW	11	101524333	missense	probably damaging	0.96
R5458:Brca1	UTSW	11	101517285	missense	possibly damaging	0.53
R5778:Brca1	UTSW	11	101525301	missense	possibly damaging	0.47
R6051:Brca1	UTSW	11	101524246	missense	probably damaging	1.00
R6505:Brca1	UTSW	11	101523541	missense	probably benign	0.03
R6548:Brca1	UTSW	11	101524765	missense	probably damaging	1.00
R6971:Brca1	UTSW	11	101534005	missense	probably benign	0.18
R7091:Brca1	UTSW	11	101526427	missense	probably benign	0.00
R7246:Brca1	UTSW	11	101523378	missense	probably benign	0.00
R7417:Brca1	UTSW	11	101524981	missense	probably damaging	1.00
R7861:Brca1	UTSW	11	101526422	missense	possibly damaging	0.87
R7925:Brca1	UTSW	11	101508146	missense	probably benign	0.01
R7932:Brca1	UTSW	11	101540017	missense	possibly damaging	0.85
R8003:Brca1	UTSW	11	101524477	missense	probably benign	0.22
R8046:Brca1	UTSW	11	101525470	missense	probably benign	0.03
R8306:Brca1	UTSW	11	101525637	missense	probably damaging	1.00
R8483:Brca1	UTSW	11	101525976	missense	probably damaging	0.99
R8685:Brca1	UTSW	11	101489846	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TCACTCTTCGAAGGAAACAGAGG -3'
(R):5'- TTGGATTAAAGGGTATTCAGCCAG -3'

Sequencing Primer
(F):5'- CTTCGAAGGAAACAGAGGGTCGAG -3'
(R):5'- TAAAGGGTATTCAGCCAGAACTC -3'

Posted On

2015-09-24