Incidental Mutation 'R4571:Abca8a'
ID342154
Institutional Source Beutler Lab
Gene Symbol Abca8a
Ensembl Gene ENSMUSG00000041828
Gene NameATP-binding cassette, sub-family A (ABC1), member 8a
Synonyms
MMRRC Submission 041795-MU
Accession Numbers

Genbank: NM_153145

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location110025634-110095978 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110030058 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1497 (C1497S)
Ref Sequence ENSEMBL: ENSMUSP00000102275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046223] [ENSMUST00000100287] [ENSMUST00000106664]
Predicted Effect probably damaging
Transcript: ENSMUST00000046223
AA Change: C1496S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045808
Gene: ENSMUSG00000041828
AA Change: C1496S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 8e-26 PFAM
AAA 505 689 6.27e-9 SMART
Pfam:ABC2_membrane_3 860 1174 6.8e-15 PFAM
transmembrane domain 1196 1218 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AAA 1313 1493 4.3e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100287
AA Change: C1497S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097860
Gene: ENSMUSG00000041828
AA Change: C1497S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 27 416 3.9e-26 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1175 3.3e-15 PFAM
transmembrane domain 1197 1219 N/A INTRINSIC
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106664
AA Change: C1497S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102275
Gene: ENSMUSG00000041828
AA Change: C1497S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.7e-23 PFAM
AAA 506 690 6.27e-9 SMART
Pfam:ABC2_membrane_3 861 1214 1.3e-12 PFAM
low complexity region 1247 1256 N/A INTRINSIC
low complexity region 1289 1302 N/A INTRINSIC
AAA 1314 1494 4.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141279
Meta Mutation Damage Score 0.7738 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Abca8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca8a APN 11 110050939 missense possibly damaging 0.52
IGL01099:Abca8a APN 11 110074205 splice site probably benign
IGL01100:Abca8a APN 11 110058423 critical splice donor site probably null
IGL01310:Abca8a APN 11 110059975 missense probably benign 0.02
IGL01357:Abca8a APN 11 110031572 missense probably benign 0.05
IGL01554:Abca8a APN 11 110042166 missense probably benign 0.24
IGL01937:Abca8a APN 11 110083304 splice site probably benign
IGL01945:Abca8a APN 11 110083304 splice site probably benign
IGL01987:Abca8a APN 11 110074155 missense possibly damaging 0.63
IGL02023:Abca8a APN 11 110063116 missense probably benign 0.04
IGL02208:Abca8a APN 11 110059946 missense probably damaging 1.00
IGL02378:Abca8a APN 11 110078815 unclassified probably benign
IGL02380:Abca8a APN 11 110078815 unclassified probably benign
IGL02387:Abca8a APN 11 110078815 unclassified probably benign
IGL02388:Abca8a APN 11 110078815 unclassified probably benign
IGL02524:Abca8a APN 11 110078815 unclassified probably benign
IGL02551:Abca8a APN 11 110084242 missense probably benign 0.05
IGL02831:Abca8a APN 11 110053081 missense probably damaging 1.00
IGL02836:Abca8a APN 11 110070351 missense possibly damaging 0.89
IGL02934:Abca8a APN 11 110040588 missense probably damaging 1.00
IGL02946:Abca8a APN 11 110028215 splice site probably benign
IGL02967:Abca8a APN 11 110050936 missense probably damaging 1.00
IGL02997:Abca8a APN 11 110075533 splice site probably benign
IGL03265:Abca8a APN 11 110053103 missense probably benign 0.01
G5030:Abca8a UTSW 11 110070339 missense probably damaging 1.00
H8562:Abca8a UTSW 11 110043009 missense probably benign
PIT4445001:Abca8a UTSW 11 110075551 missense probably damaging 0.99
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0060:Abca8a UTSW 11 110070480 missense probably damaging 1.00
R0084:Abca8a UTSW 11 110036597 splice site probably benign
R0394:Abca8a UTSW 11 110026343 missense probably damaging 0.99
R0477:Abca8a UTSW 11 110065225 missense probably benign
R0593:Abca8a UTSW 11 110068099 missense probably damaging 1.00
R0744:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0764:Abca8a UTSW 11 110059946 missense probably damaging 1.00
R0787:Abca8a UTSW 11 110042988 missense possibly damaging 0.60
R0836:Abca8a UTSW 11 110040564 missense possibly damaging 0.91
R0848:Abca8a UTSW 11 110028190 missense probably damaging 1.00
R0894:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1163:Abca8a UTSW 11 110071530 missense probably benign 0.01
R1224:Abca8a UTSW 11 110040582 missense probably damaging 1.00
R1474:Abca8a UTSW 11 110069809 missense probably damaging 1.00
R1596:Abca8a UTSW 11 110068060 missense possibly damaging 0.89
R1708:Abca8a UTSW 11 110053102 missense probably damaging 1.00
R1715:Abca8a UTSW 11 110091580 missense probably damaging 0.98
R1795:Abca8a UTSW 11 110050966 missense probably benign 0.00
R1832:Abca8a UTSW 11 110071451 missense probably damaging 0.99
R1852:Abca8a UTSW 11 110069386 missense probably damaging 1.00
R1887:Abca8a UTSW 11 110089942 missense probably damaging 1.00
R1891:Abca8a UTSW 11 110091607 missense probably benign 0.20
R1917:Abca8a UTSW 11 110091515 splice site probably benign
R1943:Abca8a UTSW 11 110069863 missense probably benign 0.00
R1962:Abca8a UTSW 11 110026905 critical splice acceptor site probably null
R2016:Abca8a UTSW 11 110070387 missense probably damaging 0.99
R2037:Abca8a UTSW 11 110089984 splice site probably null
R2098:Abca8a UTSW 11 110036579 missense probably damaging 1.00
R2102:Abca8a UTSW 11 110068052 missense probably damaging 1.00
R2134:Abca8a UTSW 11 110030917 missense probably null 1.00
R2220:Abca8a UTSW 11 110026855 missense probably damaging 1.00
R2269:Abca8a UTSW 11 110026892 missense probably damaging 1.00
R2395:Abca8a UTSW 11 110068788 missense probably damaging 1.00
R2847:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R2849:Abca8a UTSW 11 110042105 missense probably damaging 1.00
R3508:Abca8a UTSW 11 110063165 missense probably benign
R3974:Abca8a UTSW 11 110083502 missense probably damaging 1.00
R4009:Abca8a UTSW 11 110090107 missense probably damaging 0.98
R4163:Abca8a UTSW 11 110050982 missense probably benign 0.00
R4274:Abca8a UTSW 11 110090104 missense probably damaging 0.96
R4507:Abca8a UTSW 11 110063025 missense probably benign 0.19
R4672:Abca8a UTSW 11 110071876 missense possibly damaging 0.94
R4700:Abca8a UTSW 11 110070482 missense probably damaging 1.00
R4770:Abca8a UTSW 11 110071515 missense possibly damaging 0.82
R4946:Abca8a UTSW 11 110086474 missense probably damaging 1.00
R4955:Abca8a UTSW 11 110036512 missense probably benign 0.00
R5186:Abca8a UTSW 11 110091599 missense probably null 0.31
R5190:Abca8a UTSW 11 110089909 critical splice donor site probably null
R5597:Abca8a UTSW 11 110036537 missense probably damaging 1.00
R5677:Abca8a UTSW 11 110038399 missense possibly damaging 0.51
R5757:Abca8a UTSW 11 110042968 missense probably benign 0.28
R5822:Abca8a UTSW 11 110030879 missense probably damaging 0.98
R5925:Abca8a UTSW 11 110057223 missense probably damaging 1.00
R6090:Abca8a UTSW 11 110063222 critical splice acceptor site probably null
R6122:Abca8a UTSW 11 110070423 missense probably benign 0.40
R6189:Abca8a UTSW 11 110030884 missense probably damaging 1.00
R6200:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R6374:Abca8a UTSW 11 110083390 nonsense probably null
R7022:Abca8a UTSW 11 110083500 missense probably damaging 1.00
R7161:Abca8a UTSW 11 110074142 missense probably benign 0.09
R7198:Abca8a UTSW 11 110078655 missense probably damaging 1.00
R7220:Abca8a UTSW 11 110089967 missense probably benign 0.00
R7290:Abca8a UTSW 11 110030888 missense probably benign 0.03
R7381:Abca8a UTSW 11 110030087 splice site probably null
R7437:Abca8a UTSW 11 110050964 missense probably benign
R7733:Abca8a UTSW 11 110054587 missense probably benign 0.02
R7785:Abca8a UTSW 11 110074206 splice site probably null
R7917:Abca8a UTSW 11 110068107 missense probably damaging 1.00
R7948:Abca8a UTSW 11 110050979 missense probably benign
R7957:Abca8a UTSW 11 110091613 start codon destroyed probably null 1.00
R7958:Abca8a UTSW 11 110031672 missense probably damaging 1.00
R7981:Abca8a UTSW 11 110089913 missense probably benign 0.00
R8033:Abca8a UTSW 11 110036522 missense probably damaging 1.00
R8069:Abca8a UTSW 11 110090050 missense probably damaging 0.98
R8116:Abca8a UTSW 11 110091594 missense probably benign 0.27
R8334:Abca8a UTSW 11 110068824 missense probably damaging 1.00
R8371:Abca8a UTSW 11 110054647 missense probably benign 0.31
R8406:Abca8a UTSW 11 110086517 missense probably damaging 1.00
R8438:Abca8a UTSW 11 110075578 missense probably damaging 1.00
X0022:Abca8a UTSW 11 110031097 missense probably damaging 1.00
X0024:Abca8a UTSW 11 110083335 missense probably damaging 1.00
X0053:Abca8a UTSW 11 110083484 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGTTGGCAGACATGTGTACTC -3'
(R):5'- CCACTCTGTGATGATCAGATGAAAC -3'

Sequencing Primer
(F):5'- CATGTGTACTCATGTGGACAGAC -3'
(R):5'- GTGATGATCAGATGAAACGAATTTGC -3'
Posted On2015-09-24