Incidental Mutation 'R4571:Btf3'
ID342159
Institutional Source Beutler Lab
Gene Symbol Btf3
Ensembl Gene ENSMUSG00000021660
Gene Namebasic transcription factor 3
Synonyms
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location98309896-98317006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98313284 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 65 (F65L)
Ref Sequence ENSEMBL: ENSMUSP00000118093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022163] [ENSMUST00000134542] [ENSMUST00000152704]
Predicted Effect probably benign
Transcript: ENSMUST00000022163
AA Change: F107L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022163
Gene: ENSMUSG00000021660
AA Change: F107L

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Pfam:NAC 83 139 6.2e-30 PFAM
low complexity region 182 193 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062252
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133826
Predicted Effect probably benign
Transcript: ENSMUST00000134542
AA Change: F65L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115500
Gene: ENSMUSG00000021660
AA Change: F65L

DomainStartEndE-ValueType
Pfam:NAC 41 98 1.9e-26 PFAM
low complexity region 140 151 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135572
Predicted Effect probably benign
Transcript: ENSMUST00000152704
AA Change: F65L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118093
Gene: ENSMUSG00000021660
AA Change: F65L

DomainStartEndE-ValueType
Pfam:NAC 41 98 1.9e-26 PFAM
low complexity region 140 151 N/A INTRINSIC
Meta Mutation Damage Score 0.3082 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the basic transcription factor 3. This protein forms a stable complex with RNA polymerase IIB and is required for transcriptional initiation. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertional mutation results in homozygous embryonic lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Btf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02613:Btf3 APN 13 98310206 unclassified probably benign
R1726:Btf3 UTSW 13 98316296 start codon destroyed probably null 0.01
R1740:Btf3 UTSW 13 98316296 start codon destroyed probably null 0.01
R1741:Btf3 UTSW 13 98316296 start codon destroyed probably null 0.01
R1742:Btf3 UTSW 13 98316296 start codon destroyed probably null 0.01
R2096:Btf3 UTSW 13 98313151 missense possibly damaging 0.94
R3106:Btf3 UTSW 13 98310988 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAAGTACAGTGACTCTAAGG -3'
(R):5'- GTGAAGCCAGAAAGCTGTTCC -3'

Sequencing Primer
(F):5'- ATACTCACATTGTTTGGGCAGAGC -3'
(R):5'- GCCAGAAAGCTGTTCCTTTATAC -3'
Posted On2015-09-24