Incidental Mutation 'R4571:C2'
ID342169
Institutional Source Beutler Lab
Gene Symbol C2
Ensembl Gene ENSMUSG00000024371
Gene Namecomplement component 2 (within H-2S)
Synonymsclassical-complement pathway C3/C5 convertase
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34862604-34898265 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34863659 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 495 (N495D)
Ref Sequence ENSEMBL: ENSMUSP00000123536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000025230] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417] [ENSMUST00000154526] [ENSMUST00000176203]
Predicted Effect probably benign
Transcript: ENSMUST00000025229
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025230
AA Change: N632D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371
AA Change: N632D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127795
Predicted Effect probably benign
Transcript: ENSMUST00000128767
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129891
AA Change: N248D
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511
AA Change: N248D

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134300
SMART Domains Protein: ENSMUSP00000114241
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
Tryp_SPc 3 148 6.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000146299
AA Change: N479D
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511
AA Change: N479D

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148431
AA Change: N355D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371
AA Change: N355D

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152417
AA Change: N495D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371
AA Change: N495D

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154526
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176203
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: This gene encodes component C2 of the classical pathway of the complement system. The encoded protein undergoes proteolytic processing mediated by component C1 resulting in C2a and C2b fragments. C2a fragment, in turn, selectively cleaves components C3 and C5 of the complement system. Mice lacking the encoded protein are found to be more susceptible to bacterial infections. Mutations in the human homolog of this gene are associated with disorders such as systemic lupus erythematosus, Henoch-Schonlein purpura, or polymyositis. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Ddx11 T C 17: 66,130,773 C165R probably benign Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in C2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:C2 APN 17 34866563 missense probably damaging 1.00
IGL02249:C2 APN 17 34864508 unclassified probably benign
IGL02568:C2 APN 17 34864349 missense possibly damaging 0.50
IGL03013:C2 APN 17 34872459 missense probably damaging 0.98
R0142:C2 UTSW 17 34873528 missense possibly damaging 0.53
R0619:C2 UTSW 17 34872503 missense probably damaging 1.00
R1401:C2 UTSW 17 34872481 missense possibly damaging 0.71
R1639:C2 UTSW 17 34872403 missense probably benign 0.02
R1808:C2 UTSW 17 34864532 missense probably damaging 1.00
R2133:C2 UTSW 17 34879902 missense probably damaging 1.00
R2860:C2 UTSW 17 34863878 missense possibly damaging 0.94
R2861:C2 UTSW 17 34863878 missense possibly damaging 0.94
R3882:C2 UTSW 17 34873489 missense probably benign 0.00
R4622:C2 UTSW 17 34863674 missense probably damaging 0.99
R5611:C2 UTSW 17 34872384 missense probably damaging 0.99
R5767:C2 UTSW 17 34876456 missense possibly damaging 0.58
R6327:C2 UTSW 17 34864103 missense probably benign 0.41
R6448:C2 UTSW 17 34863359 missense possibly damaging 0.67
R6518:C2 UTSW 17 34864118 missense probably damaging 1.00
R6929:C2 UTSW 17 34864347 missense possibly damaging 0.68
R7324:C2 UTSW 17 34881688 missense probably benign 0.13
R7446:C2 UTSW 17 34876010 missense probably damaging 1.00
R7456:C2 UTSW 17 34864582 missense probably damaging 1.00
R7479:C2 UTSW 17 34863465 missense probably damaging 1.00
R7807:C2 UTSW 17 34876371 missense possibly damaging 0.79
R7943:C2 UTSW 17 34872378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATACACCTTGTCCACTGCG -3'
(R):5'- AAGATCATGGTGAGTGCTGG -3'

Sequencing Primer
(F):5'- ACCTTGTCCACTGCGGTGTG -3'
(R):5'- TCTTGGTGGGTTGCAGCCAG -3'
Posted On2015-09-24