Incidental Mutation 'R4571:Ddx11'
ID342172
Institutional Source Beutler Lab
Gene Symbol Ddx11
Ensembl Gene ENSMUSG00000035842
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
SynonymsCHL1, 4732462I11Rik, CHLR1, essa15a, KRG2
MMRRC Submission 041795-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4571 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location66123520-66152174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66130773 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 165 (C165R)
Ref Sequence ENSEMBL: ENSMUSP00000152906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163605] [ENSMUST00000224497] [ENSMUST00000224903] [ENSMUST00000225956]
Predicted Effect probably benign
Transcript: ENSMUST00000163605
AA Change: C165R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130440
Gene: ENSMUSG00000035842
AA Change: C165R

DomainStartEndE-ValueType
DEXDc 11 408 1.14e-153 SMART
Blast:DEXDc2 430 479 6e-14 BLAST
HELICc 682 839 1.4e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223600
Predicted Effect probably benign
Transcript: ENSMUST00000224497
AA Change: C191R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000224903
AA Change: C191R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225687
Predicted Effect probably benign
Transcript: ENSMUST00000225956
AA Change: C165R

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an enzyme that possesses both ATPase and DNA helicase activities. This gene is a homolog of the yeast CHL1 gene, and may function to maintain chromosome transmission fidelity and genome stability. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before E11.5 with growth retardation, failure of chorioallantoic fusion, poor placental labyrinth development, and embryonic cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T A 6: 96,164,881 N394I probably damaging Het
Abca8a A T 11: 110,030,058 C1497S probably damaging Het
Acoxl G T 2: 127,877,807 G163W probably damaging Het
Apbb1 T A 7: 105,573,762 N214I probably damaging Het
Apol7b T C 15: 77,423,534 K254E probably benign Het
Arl4d T A 11: 101,667,143 V165E possibly damaging Het
Brca1 C A 11: 101,517,366 R1377L probably benign Het
Btf3 A G 13: 98,313,284 F65L probably benign Het
C2 T C 17: 34,863,659 N495D probably benign Het
Cacna1c T C 6: 118,630,380 T1188A probably benign Het
Chd7 C A 4: 8,866,217 D796E probably benign Het
Clasp2 G T 9: 113,847,721 L173F probably damaging Het
Clec4g A T 8: 3,718,766 probably null Het
Col9a3 T C 2: 180,616,366 probably benign Het
Csmd2 T A 4: 128,480,095 probably null Het
Dnah7c A C 1: 46,533,216 M950L probably damaging Het
Dusp23 A C 1: 172,632,614 probably null Het
Ebag9 A T 15: 44,636,762 probably null Het
Edn3 G A 2: 174,781,904 A211T probably benign Het
Eif3e G A 15: 43,266,162 T190I possibly damaging Het
Fam76a T C 4: 132,920,897 H3R possibly damaging Het
Gabbr1 G T 17: 37,054,236 E138* probably null Het
Galc T C 12: 98,222,617 T412A probably benign Het
Gimap3 T C 6: 48,765,720 D92G possibly damaging Het
Gin1 T C 1: 97,785,076 Y285H probably damaging Het
Gm4868 A G 5: 125,848,718 noncoding transcript Het
Gm7052 T A 17: 22,040,424 probably benign Het
Gpcpd1 T A 2: 132,550,350 E226D probably benign Het
Hoxb4 T C 11: 96,319,166 S133P possibly damaging Het
Hrg C T 16: 22,961,222 probably benign Het
Insrr A G 3: 87,800,887 K212R probably benign Het
Ipp A G 4: 116,530,458 D411G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnq3 A G 15: 66,030,612 F172L probably damaging Het
Kdm5d T C Y: 927,110 F616S probably damaging Het
Lars T C 18: 42,228,230 probably null Het
Lmo7 G T 14: 101,887,594 Q496H probably damaging Het
Map3k9 C A 12: 81,734,091 A432S probably benign Het
Nop2 T G 6: 125,140,881 probably null Het
Olfr1029 A T 2: 85,975,831 E196V probably damaging Het
Olfr1115 C A 2: 87,252,458 Q174K possibly damaging Het
Olfr420 A T 1: 174,158,928 N52Y possibly damaging Het
Olfr90 T C 17: 37,085,579 I195M probably damaging Het
Pan2 A G 10: 128,308,643 T187A probably benign Het
Pcmtd2 A G 2: 181,842,424 E9G possibly damaging Het
Pik3cb T A 9: 99,090,257 I283F possibly damaging Het
Pkhd1 G A 1: 20,613,409 T40I probably damaging Het
Plxna2 T C 1: 194,810,988 V1857A possibly damaging Het
Polg T C 7: 79,460,379 S334G probably damaging Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rpl5-ps2 G T 2: 154,704,236 noncoding transcript Het
Slc6a18 A T 13: 73,666,370 N468K possibly damaging Het
Slco4a1 A T 2: 180,464,378 T118S probably benign Het
Smg1 A T 7: 118,139,465 N3520K possibly damaging Het
Tapbp C A 17: 33,926,453 D415E probably damaging Het
Topaz1 A G 9: 122,747,436 T31A probably benign Het
Trpv6 C T 6: 41,621,744 R649H probably damaging Het
Vmn1r188 A G 13: 22,088,518 Y214C probably benign Het
Vps8 T A 16: 21,435,775 I59N probably damaging Het
Wnt9a T C 11: 59,331,337 C354R probably damaging Het
Zcchc2 A G 1: 106,031,257 T1153A possibly damaging Het
Zfp30 A G 7: 29,793,202 R294G probably damaging Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Zfp62 A C 11: 49,215,741 S220R probably damaging Het
Zfp62 G T 11: 49,215,742 S220I probably damaging Het
Zp3r A G 1: 130,578,020 S423P probably damaging Het
Other mutations in Ddx11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ddx11 APN 17 66134137 missense probably damaging 1.00
IGL01577:Ddx11 APN 17 66139403 missense possibly damaging 0.95
IGL02558:Ddx11 APN 17 66148672 missense probably damaging 0.99
IGL02801:Ddx11 APN 17 66148033 missense probably benign 0.03
R1550:Ddx11 UTSW 17 66138220 missense probably benign 0.16
R1587:Ddx11 UTSW 17 66149256 missense probably damaging 1.00
R1601:Ddx11 UTSW 17 66150385 missense probably damaging 1.00
R1625:Ddx11 UTSW 17 66150697 missense probably benign 0.45
R1714:Ddx11 UTSW 17 66148759 missense probably damaging 1.00
R1867:Ddx11 UTSW 17 66135939 splice site probably null
R1959:Ddx11 UTSW 17 66130728 missense probably benign 0.27
R1980:Ddx11 UTSW 17 66148739 missense probably damaging 0.97
R2392:Ddx11 UTSW 17 66149973 missense probably damaging 1.00
R3118:Ddx11 UTSW 17 66149277 missense probably damaging 1.00
R3425:Ddx11 UTSW 17 66139439 missense possibly damaging 0.62
R3983:Ddx11 UTSW 17 66134130 missense probably damaging 1.00
R4576:Ddx11 UTSW 17 66150726 missense probably damaging 1.00
R4847:Ddx11 UTSW 17 66130801 missense probably damaging 1.00
R5010:Ddx11 UTSW 17 66147722 missense possibly damaging 0.60
R5414:Ddx11 UTSW 17 66148768 missense probably benign 0.40
R5610:Ddx11 UTSW 17 66150026 missense probably damaging 1.00
R5822:Ddx11 UTSW 17 66129981 missense probably benign 0.00
R5972:Ddx11 UTSW 17 66148090 missense probably benign 0.05
R6017:Ddx11 UTSW 17 66130017 missense probably benign 0.02
R6267:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R6296:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R7205:Ddx11 UTSW 17 66130771 missense probably benign 0.25
R7531:Ddx11 UTSW 17 66138219 missense probably benign 0.00
R7544:Ddx11 UTSW 17 66126285 missense probably damaging 0.98
R7593:Ddx11 UTSW 17 66126198 missense possibly damaging 0.48
R7598:Ddx11 UTSW 17 66130546 splice site probably null
R7778:Ddx11 UTSW 17 66130548 critical splice donor site probably null
R7824:Ddx11 UTSW 17 66130548 critical splice donor site probably null
R8087:Ddx11 UTSW 17 66149993 missense probably damaging 1.00
R8379:Ddx11 UTSW 17 66130025 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGATTGAAGTGACAGACCG -3'
(R):5'- ACATACATGGGACTGTCACAG -3'

Sequencing Primer
(F):5'- TTGAAGTGACAGACCGGAGCG -3'
(R):5'- CTGTCACAGAATAAAGGGTCAACCG -3'
Posted On2015-09-24