Mutagenetix > Incidental Mutation

Incidental Mutation 'R4572:Ino80'

342177

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

041796-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119402358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 1160 (R1160W)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]

AlphaFold

Q6ZPV2

Predicted Effect

probably damaging
Transcript: ENSMUST00000049920
AA Change: R1160W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: R1160W

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110808

SMART Domains

Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	272	412	8.8e-55	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
PDB:3MWY\|W	1098	1136	6e-7	PDB

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00
R9621:Ino80	UTSW	2	119450015	missense	probably damaging	0.98
R9641:Ino80	UTSW	2	119445484	missense	probably benign	0.08
R9650:Ino80	UTSW	2	119446983	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGACACACATGCACACAT -3'
(R):5'- TCTGAGTTGATCTTGAATTTCAGGA -3'

Sequencing Primer
(F):5'- CAAAAGGTGCACACTAGTG -3'
(R):5'- CCCCTTTCTGTGTATAGTGAATTGAG -3'

Posted On

2015-09-24