Incidental Mutation 'R4572:Zmym1'
ID 342184
Institutional Source Beutler Lab
Gene Symbol Zmym1
Ensembl Gene ENSMUSG00000043872
Gene Name zinc finger, MYM domain containing 1
Synonyms
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 127047094-127061152 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 127050835 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 186 (N186K)
Ref Sequence ENSEMBL: ENSMUSP00000101708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055013] [ENSMUST00000106099] [ENSMUST00000106102] [ENSMUST00000136186]
AlphaFold Q3TJB1
Predicted Effect probably benign
Transcript: ENSMUST00000055013
AA Change: N186K

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000050669
Gene: ENSMUSG00000043872
AA Change: N186K

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 2.4e-8 PFAM
Pfam:zf-FCS 53 96 1.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 4.9e-55 PFAM
Pfam:Dimer_Tnp_hAT 870 959 5.1e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000106099
AA Change: N186K
SMART Domains Protein: ENSMUSP00000101705
Gene: ENSMUSG00000043872
AA Change: N186K

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 3.3e-9 PFAM
Pfam:zf-FCS 53 96 4.6e-10 PFAM
low complexity region 155 168 N/A INTRINSIC
Pfam:DUF4371 237 471 2.8e-52 PFAM
Pfam:Dimer_Tnp_hAT 772 861 5.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106102
AA Change: N186K

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101708
Gene: ENSMUSG00000043872
AA Change: N186K

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 7.8e-9 PFAM
Pfam:zf-FCS 53 96 1.1e-9 PFAM
low complexity region 155 168 N/A INTRINSIC
low complexity region 229 243 N/A INTRINSIC
Pfam:DUF4371 335 569 7.4e-52 PFAM
Pfam:Dimer_Tnp_hAT 870 959 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124429
Predicted Effect probably benign
Transcript: ENSMUST00000136186
SMART Domains Protein: ENSMUSP00000120772
Gene: ENSMUSG00000043872

DomainStartEndE-ValueType
Pfam:zf-FCS 6 46 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152607
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Other mutations in Zmym1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Zmym1 APN 4 127049642 missense probably damaging 1.00
IGL02326:Zmym1 APN 4 127047760 missense probably damaging 1.00
IGL02392:Zmym1 APN 4 127048463 missense probably damaging 1.00
IGL02431:Zmym1 APN 4 127047764 nonsense probably null
IGL02512:Zmym1 APN 4 127048672 missense probably damaging 1.00
IGL03303:Zmym1 APN 4 127049134 missense probably damaging 1.00
BB009:Zmym1 UTSW 4 127050785 missense possibly damaging 0.77
BB019:Zmym1 UTSW 4 127050785 missense possibly damaging 0.77
R0195:Zmym1 UTSW 4 127047911 missense possibly damaging 0.85
R0266:Zmym1 UTSW 4 127048025 missense possibly damaging 0.86
R0416:Zmym1 UTSW 4 127058820 missense probably benign 0.00
R1374:Zmym1 UTSW 4 127049611 missense probably damaging 1.00
R1480:Zmym1 UTSW 4 127048612 missense probably damaging 0.99
R1704:Zmym1 UTSW 4 127048384 missense probably damaging 1.00
R1806:Zmym1 UTSW 4 127048079 missense probably damaging 1.00
R1815:Zmym1 UTSW 4 127049021 missense possibly damaging 0.76
R2124:Zmym1 UTSW 4 127049570 missense probably benign 0.05
R2169:Zmym1 UTSW 4 127054203 splice site probably null
R4027:Zmym1 UTSW 4 127049879 missense probably benign 0.08
R4410:Zmym1 UTSW 4 127048104 nonsense probably null
R4788:Zmym1 UTSW 4 127054297 missense probably benign 0.10
R5120:Zmym1 UTSW 4 127051437 splice site probably null
R5130:Zmym1 UTSW 4 127048658 missense probably damaging 1.00
R5615:Zmym1 UTSW 4 127049398 missense probably damaging 1.00
R6190:Zmym1 UTSW 4 127047884 missense probably damaging 0.99
R7426:Zmym1 UTSW 4 127049398 missense possibly damaging 0.81
R7464:Zmym1 UTSW 4 127058935 nonsense probably null
R7540:Zmym1 UTSW 4 127048757 missense probably benign
R7779:Zmym1 UTSW 4 127054245 missense probably benign
R7807:Zmym1 UTSW 4 127047874 missense probably damaging 1.00
R7876:Zmym1 UTSW 4 127047703 missense probably damaging 0.98
R7932:Zmym1 UTSW 4 127050785 missense possibly damaging 0.77
R8183:Zmym1 UTSW 4 127058856 missense probably benign 0.07
R8276:Zmym1 UTSW 4 127054258 missense probably damaging 0.99
R8744:Zmym1 UTSW 4 127051372 missense probably damaging 1.00
R8798:Zmym1 UTSW 4 127049871 missense possibly damaging 0.90
R9199:Zmym1 UTSW 4 127050830 missense possibly damaging 0.80
R9385:Zmym1 UTSW 4 127058890 missense probably damaging 1.00
T0722:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0722:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0722:Zmym1 UTSW 4 127049673 missense probably benign 0.05
T0975:Zmym1 UTSW 4 127047947 missense probably benign 0.00
T0975:Zmym1 UTSW 4 127048250 missense probably benign 0.01
T0975:Zmym1 UTSW 4 127049673 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGTCGAGACAAATGAAAGCAC -3'
(R):5'- ATGCCCACCAGGTGTTATG -3'

Sequencing Primer
(F):5'- CACTTTAATAGCACCATAAGCTCATG -3'
(R):5'- TATGGTGGGCAAGCATTCTCCC -3'
Posted On 2015-09-24