Incidental Mutation 'R4572:C130060K24Rik'
ID 342189
Institutional Source Beutler Lab
Gene Symbol C130060K24Rik
Ensembl Gene ENSMUSG00000029917
Gene Name RIKEN cDNA C130060K24 gene
Synonyms
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 65381105-65458150 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65454991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 293 (M293L)
Ref Sequence ENSEMBL: ENSMUSP00000130225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133352] [ENSMUST00000170608]
AlphaFold G3UWA8
Predicted Effect probably benign
Transcript: ENSMUST00000133352
SMART Domains Protein: ENSMUSP00000122416
Gene: ENSMUSG00000029917

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 113 1.2e-7 PFAM
Pfam:7tm_1 61 122 1.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136016
SMART Domains Protein: ENSMUSP00000121875
Gene: ENSMUSG00000029917

DomainStartEndE-ValueType
transmembrane domain 45 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170608
AA Change: M293L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130225
Gene: ENSMUSG00000029917
AA Change: M293L

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 55 346 2.5e-5 PFAM
Pfam:7tm_1 61 331 7.2e-56 PFAM
Meta Mutation Damage Score 0.1429 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in C130060K24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02084:C130060K24Rik APN 6 65381610 missense probably benign 0.36
IGL03335:C130060K24Rik APN 6 65453117 critical splice donor site probably null
R1291:C130060K24Rik UTSW 6 65452900 nonsense probably null
R1689:C130060K24Rik UTSW 6 65381607 missense possibly damaging 0.84
R1705:C130060K24Rik UTSW 6 65456306 missense probably benign 0.01
R2188:C130060K24Rik UTSW 6 65441276 missense probably damaging 0.97
R3955:C130060K24Rik UTSW 6 65453108 missense possibly damaging 0.73
R4058:C130060K24Rik UTSW 6 65381541 missense probably damaging 1.00
R4597:C130060K24Rik UTSW 6 65447424 critical splice donor site probably null
R4756:C130060K24Rik UTSW 6 65452914 missense probably benign 0.02
R5139:C130060K24Rik UTSW 6 65456219 missense probably damaging 0.98
R5872:C130060K24Rik UTSW 6 65441385 intron probably benign
R6193:C130060K24Rik UTSW 6 65456158 missense probably damaging 1.00
R6305:C130060K24Rik UTSW 6 65454991 missense probably benign 0.06
R6423:C130060K24Rik UTSW 6 65456093 missense probably benign 0.01
R6453:C130060K24Rik UTSW 6 65453030 missense possibly damaging 0.71
R6677:C130060K24Rik UTSW 6 65456245 missense probably benign
R6744:C130060K24Rik UTSW 6 65441340 missense possibly damaging 0.88
R6793:C130060K24Rik UTSW 6 65381421 missense probably benign 0.20
R6875:C130060K24Rik UTSW 6 65456336 missense probably benign 0.21
R6941:C130060K24Rik UTSW 6 65447401 missense probably damaging 1.00
R6995:C130060K24Rik UTSW 6 65441301 missense probably damaging 1.00
R7063:C130060K24Rik UTSW 6 65441403 intron probably benign
R7564:C130060K24Rik UTSW 6 65452907 nonsense probably null
R7699:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7700:C130060K24Rik UTSW 6 65452956 missense probably benign 0.30
R7711:C130060K24Rik UTSW 6 65441373 missense
R7799:C130060K24Rik UTSW 6 65456137 missense possibly damaging 0.78
R7801:C130060K24Rik UTSW 6 65441217 missense probably damaging 1.00
R8737:C130060K24Rik UTSW 6 65456276 missense probably benign
R8762:C130060K24Rik UTSW 6 65447409 missense probably benign 0.12
R8927:C130060K24Rik UTSW 6 65381613 nonsense probably null
R8928:C130060K24Rik UTSW 6 65381613 nonsense probably null
R9317:C130060K24Rik UTSW 6 65447384 missense probably benign 0.10
R9405:C130060K24Rik UTSW 6 65456094 missense not run
RF018:C130060K24Rik UTSW 6 65456190 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCATAGCCTCAGGAACTC -3'
(R):5'- GTCACCTACCACATGATGACCTG -3'

Sequencing Primer
(F):5'- TGCATGAAAACATGTGGTCTAGTGC -3'
(R):5'- AGACTACACATGAGATGGG -3'
Posted On 2015-09-24