Incidental Mutation 'R4572:Trim30a'
ID 342193
Institutional Source Beutler Lab
Gene Symbol Trim30a
Ensembl Gene ENSMUSG00000030921
Gene Name tripartite motif-containing 30A
Synonyms Rpt-1, Rpt1, Trim30
MMRRC Submission 041796-MU
Accession Numbers

Ncbi RefSeq: NM_009099.2; MGI:98178

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 104409025-104465193 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 104411188 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 460 (C460*)
Ref Sequence ENSEMBL: ENSMUSP00000076189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076922]
AlphaFold P15533
PDB Structure Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000076922
AA Change: C460*
SMART Domains Protein: ENSMUSP00000076189
Gene: ENSMUSG00000030921
AA Change: C460*

DomainStartEndE-ValueType
RING 15 58 2.88e-10 SMART
BBOX 91 132 3.52e-14 SMART
coiled coil region 173 241 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
Pfam:SPRY 349 493 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211270
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygous null mice show increased CD4/CD8 ratio with age, an abnormal CD4+ T cell response upon TCR activation, and reduced effector function of CD4+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Trim30a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02677:Trim30a APN 7 104435913 missense probably damaging 1.00
IGL02944:Trim30a APN 7 104435777 missense probably benign 0.19
IGL03135:Trim30a APN 7 104411141 missense probably damaging 0.98
BB009:Trim30a UTSW 7 104429338 missense probably benign 0.00
BB019:Trim30a UTSW 7 104429338 missense probably benign 0.00
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0049:Trim30a UTSW 7 104429352 critical splice acceptor site probably null
R0682:Trim30a UTSW 7 104429182 missense probably damaging 1.00
R1773:Trim30a UTSW 7 104435901 missense probably damaging 1.00
R1862:Trim30a UTSW 7 104411198 missense probably damaging 0.99
R1872:Trim30a UTSW 7 104429210 missense probably benign 0.01
R1986:Trim30a UTSW 7 104411465 missense probably damaging 1.00
R1991:Trim30a UTSW 7 104430230 splice site probably benign
R2259:Trim30a UTSW 7 104411504 missense probably damaging 1.00
R2571:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R3719:Trim30a UTSW 7 104411163 missense probably benign 0.00
R3880:Trim30a UTSW 7 104411189 missense probably benign
R3910:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R3911:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R3912:Trim30a UTSW 7 104411141 missense probably damaging 0.98
R4343:Trim30a UTSW 7 104435592 missense probably benign 0.00
R4587:Trim30a UTSW 7 104435644 nonsense probably null
R4997:Trim30a UTSW 7 104411620 missense probably benign 0.21
R5051:Trim30a UTSW 7 104411706 intron probably benign
R5414:Trim30a UTSW 7 104411141 missense probably damaging 1.00
R5613:Trim30a UTSW 7 104430182 missense probably damaging 1.00
R5930:Trim30a UTSW 7 104421450 missense possibly damaging 0.95
R6262:Trim30a UTSW 7 104411534 missense probably benign 0.00
R7133:Trim30a UTSW 7 104429326 missense possibly damaging 0.93
R7222:Trim30a UTSW 7 104421432 splice site probably null
R7739:Trim30a UTSW 7 104430179 missense possibly damaging 0.50
R7797:Trim30a UTSW 7 104411200 missense possibly damaging 0.86
R7803:Trim30a UTSW 7 104411397 nonsense probably null
R7836:Trim30a UTSW 7 104435595 missense probably benign 0.06
R7908:Trim30a UTSW 7 104421449 missense probably benign 0.01
R7932:Trim30a UTSW 7 104429338 missense probably benign 0.00
R7934:Trim30a UTSW 7 104412241 missense probably damaging 1.00
R8240:Trim30a UTSW 7 104421456 missense probably benign 0.01
R8405:Trim30a UTSW 7 104411542 nonsense probably null
R8778:Trim30a UTSW 7 104411565 missense probably benign 0.30
R8825:Trim30a UTSW 7 104411322 nonsense probably null
R9022:Trim30a UTSW 7 104435749 missense probably benign 0.03
R9423:Trim30a UTSW 7 104429203 missense probably damaging 1.00
X0012:Trim30a UTSW 7 104430203 nonsense probably null
Z1088:Trim30a UTSW 7 104435654 missense probably damaging 1.00
Z1177:Trim30a UTSW 7 104411463 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGCATAAGATACACCAGACATG -3'
(R):5'- AGCCTAAATGTGGCTACTGG -3'

Sequencing Primer
(F):5'- CAGACATGGGGGCACTG -3'
(R):5'- CCTAAATGTGGCTACTGGGTTATAG -3'
Posted On 2015-09-24