Mutagenetix > Incidental Mutation

Incidental Mutation 'R4572:Trim30a'

342193

Institutional Source

Beutler Lab

Gene Symbol

Trim30a

Ensembl Gene

ENSMUSG00000030921

Gene Name

tripartite motif-containing 30A

Synonyms

Rpt-1, Rpt1, Trim30

MMRRC Submission

041796-MU

Accession Numbers

Ncbi RefSeq: NM_009099.2; MGI:98178

Essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104409025-104465193 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 104411188 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 460 (C460*)

Ref Sequence

ENSEMBL: ENSMUSP00000076189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076922]

AlphaFold

P15533

PDB Structure

Solution structure of the Zinc finger, C3HC4 type (RING finger) domain Tripartite motif protein 30 [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000076922
AA Change: C460*

SMART Domains

Protein: ENSMUSP00000076189
Gene: ENSMUSG00000030921
AA Change: C460*

Domain	Start	End	E-Value	Type
RING	15	58	2.88e-10	SMART
BBOX	91	132	3.52e-14	SMART
coiled coil region	173	241	N/A	INTRINSIC
low complexity region	255	265	N/A	INTRINSIC
Pfam:SPRY	349	493	1.6e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125762

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211270

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

PHENOTYPE: Homozygous null mice show increased CD4/CD8 ratio with age, an abnormal CD4+ T cell response upon TCR activation, and reduced effector function of CD4+ T cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Trim30a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02677:Trim30a	APN	7	104435913	missense	probably damaging	1.00
IGL02944:Trim30a	APN	7	104435777	missense	probably benign	0.19
IGL03135:Trim30a	APN	7	104411141	missense	probably damaging	0.98
BB009:Trim30a	UTSW	7	104429338	missense	probably benign	0.00
BB019:Trim30a	UTSW	7	104429338	missense	probably benign	0.00
R0049:Trim30a	UTSW	7	104429352	critical splice acceptor site	probably null
R0049:Trim30a	UTSW	7	104429352	critical splice acceptor site	probably null
R0682:Trim30a	UTSW	7	104429182	missense	probably damaging	1.00
R1773:Trim30a	UTSW	7	104435901	missense	probably damaging	1.00
R1862:Trim30a	UTSW	7	104411198	missense	probably damaging	0.99
R1872:Trim30a	UTSW	7	104429210	missense	probably benign	0.01
R1986:Trim30a	UTSW	7	104411465	missense	probably damaging	1.00
R1991:Trim30a	UTSW	7	104430230	splice site	probably benign
R2259:Trim30a	UTSW	7	104411504	missense	probably damaging	1.00
R2571:Trim30a	UTSW	7	104429326	missense	possibly damaging	0.93
R3719:Trim30a	UTSW	7	104411163	missense	probably benign	0.00
R3880:Trim30a	UTSW	7	104411189	missense	probably benign
R3910:Trim30a	UTSW	7	104411141	missense	probably damaging	0.98
R3911:Trim30a	UTSW	7	104411141	missense	probably damaging	0.98
R3912:Trim30a	UTSW	7	104411141	missense	probably damaging	0.98
R4343:Trim30a	UTSW	7	104435592	missense	probably benign	0.00
R4587:Trim30a	UTSW	7	104435644	nonsense	probably null
R4997:Trim30a	UTSW	7	104411620	missense	probably benign	0.21
R5051:Trim30a	UTSW	7	104411706	intron	probably benign
R5414:Trim30a	UTSW	7	104411141	missense	probably damaging	1.00
R5613:Trim30a	UTSW	7	104430182	missense	probably damaging	1.00
R5930:Trim30a	UTSW	7	104421450	missense	possibly damaging	0.95
R6262:Trim30a	UTSW	7	104411534	missense	probably benign	0.00
R7133:Trim30a	UTSW	7	104429326	missense	possibly damaging	0.93
R7222:Trim30a	UTSW	7	104421432	splice site	probably null
R7739:Trim30a	UTSW	7	104430179	missense	possibly damaging	0.50
R7797:Trim30a	UTSW	7	104411200	missense	possibly damaging	0.86
R7803:Trim30a	UTSW	7	104411397	nonsense	probably null
R7836:Trim30a	UTSW	7	104435595	missense	probably benign	0.06
R7908:Trim30a	UTSW	7	104421449	missense	probably benign	0.01
R7932:Trim30a	UTSW	7	104429338	missense	probably benign	0.00
R7934:Trim30a	UTSW	7	104412241	missense	probably damaging	1.00
R8240:Trim30a	UTSW	7	104421456	missense	probably benign	0.01
R8405:Trim30a	UTSW	7	104411542	nonsense	probably null
R8778:Trim30a	UTSW	7	104411565	missense	probably benign	0.30
R8825:Trim30a	UTSW	7	104411322	nonsense	probably null
R9022:Trim30a	UTSW	7	104435749	missense	probably benign	0.03
R9423:Trim30a	UTSW	7	104429203	missense	probably damaging	1.00
R9492:Trim30a	UTSW	7	104429123	missense	probably damaging	0.99
X0012:Trim30a	UTSW	7	104430203	nonsense	probably null
Z1088:Trim30a	UTSW	7	104435654	missense	probably damaging	1.00
Z1177:Trim30a	UTSW	7	104411463	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGCATAAGATACACCAGACATG -3'
(R):5'- AGCCTAAATGTGGCTACTGG -3'

Sequencing Primer
(F):5'- CAGACATGGGGGCACTG -3'
(R):5'- CCTAAATGTGGCTACTGGGTTATAG -3'

Posted On

2015-09-24