Incidental Mutation 'R4572:Cilp2'
ID342197
Institutional Source Beutler Lab
Gene Symbol Cilp2
Ensembl Gene ENSMUSG00000044006
Gene Namecartilage intermediate layer protein 2
Synonyms1110031K21Rik, CLIP-2
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4572 (G1)
Quality Score111
Status Validated
Chromosome8
Chromosomal Location69880369-69887687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69882410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 646 (V646A)
Ref Sequence ENSEMBL: ENSMUSP00000061544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057831]
Predicted Effect probably damaging
Transcript: ENSMUST00000057831
AA Change: V646A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061544
Gene: ENSMUSG00000044006
AA Change: V646A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Mucin2_WxxW 58 143 2.5e-22 PFAM
TSP1 149 197 1.33e-9 SMART
Pfam:CarboxypepD_reg 210 288 4.5e-10 PFAM
IGc2 305 367 2.52e-9 SMART
low complexity region 472 481 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 693 703 N/A INTRINSIC
low complexity region 705 719 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 1041 1061 N/A INTRINSIC
Meta Mutation Damage Score 0.5702 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Cilp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Cilp2 APN 8 69882846 missense probably damaging 0.96
IGL01538:Cilp2 APN 8 69881204 missense probably benign 0.13
IGL02063:Cilp2 APN 8 69882865 missense probably damaging 1.00
IGL02582:Cilp2 APN 8 69881286 missense probably damaging 1.00
IGL02892:Cilp2 APN 8 69884320 missense probably benign 0.02
R0308:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0371:Cilp2 UTSW 8 69881606 missense probably damaging 1.00
R0413:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0414:Cilp2 UTSW 8 69882993 missense probably benign 0.00
R0470:Cilp2 UTSW 8 69885405 missense possibly damaging 0.87
R0838:Cilp2 UTSW 8 69881719 missense probably benign 0.04
R0842:Cilp2 UTSW 8 69883118 missense probably damaging 1.00
R1807:Cilp2 UTSW 8 69882194 missense probably damaging 1.00
R1864:Cilp2 UTSW 8 69881323 missense probably damaging 1.00
R2010:Cilp2 UTSW 8 69881694 missense probably damaging 1.00
R2104:Cilp2 UTSW 8 69882792 nonsense probably null
R2339:Cilp2 UTSW 8 69882894 missense probably benign 0.04
R5225:Cilp2 UTSW 8 69883365 missense probably damaging 1.00
R5923:Cilp2 UTSW 8 69882875 missense probably damaging 1.00
R6113:Cilp2 UTSW 8 69882359 missense probably benign 0.00
R6958:Cilp2 UTSW 8 69882540 missense probably benign 0.01
R7108:Cilp2 UTSW 8 69881129 missense probably damaging 1.00
R7454:Cilp2 UTSW 8 69883390 missense probably damaging 1.00
R7455:Cilp2 UTSW 8 69881071 missense probably damaging 1.00
R7598:Cilp2 UTSW 8 69886032 missense probably benign 0.29
R7736:Cilp2 UTSW 8 69881421 missense probably damaging 1.00
R7781:Cilp2 UTSW 8 69882347 missense possibly damaging 0.81
Z1088:Cilp2 UTSW 8 69885410 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGTTAAACAAGCGGCGCTC -3'
(R):5'- GAGACTTCGTAGACAGCGTC -3'

Sequencing Primer
(F):5'- AGAAACGCGCGCTCCTC -3'
(R):5'- TGTGTACCACGAGATCCGC -3'
Posted On2015-09-24