Incidental Mutation 'R4572:Terf2ip'
ID 342198
Institutional Source Beutler Lab
Gene Symbol Terf2ip
Ensembl Gene ENSMUSG00000033430
Gene Name telomeric repeat binding factor 2, interacting protein
Synonyms Rap1
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 112011398-112020528 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 112012017 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 179 (D179G)
Ref Sequence ENSEMBL: ENSMUSP00000052170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034426] [ENSMUST00000052138] [ENSMUST00000071732] [ENSMUST00000093120] [ENSMUST00000164470] [ENSMUST00000211990]
AlphaFold Q91VL8
Predicted Effect probably benign
Transcript: ENSMUST00000034426
SMART Domains Protein: ENSMUSP00000034426
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 14 53 N/A INTRINSIC
Pfam:tRNA_anti-codon 124 204 2.8e-15 PFAM
Pfam:tRNA-synt_2 220 573 4.9e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000052138
AA Change: D179G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052170
Gene: ENSMUSG00000033430
AA Change: D179G

DomainStartEndE-ValueType
Pfam:BRCT_2 17 100 1.4e-23 PFAM
Pfam:Myb_DNA-bind_2 129 193 3.9e-35 PFAM
low complexity region 279 298 N/A INTRINSIC
Pfam:Rap1_C 315 392 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071732
SMART Domains Protein: ENSMUSP00000128163
Gene: ENSMUSG00000092086

DomainStartEndE-ValueType
RRM 14 86 3.1e-26 SMART
RRM 105 177 8.1e-24 SMART
low complexity region 192 310 N/A INTRINSIC
low complexity region 321 350 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093120
SMART Domains Protein: ENSMUSP00000090808
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 3.6e-17 PFAM
Pfam:tRNA-synt_2 249 601 1.1e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164470
SMART Domains Protein: ENSMUSP00000126268
Gene: ENSMUSG00000031948

DomainStartEndE-ValueType
coiled coil region 44 82 N/A INTRINSIC
Pfam:tRNA_anti-codon 153 233 1.6e-16 PFAM
Pfam:tRNA-synt_2 249 602 1.8e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211978
Predicted Effect probably benign
Transcript: ENSMUST00000211990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212732
Meta Mutation Damage Score 0.5709 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that is part of a complex involved in telomere length regulation. Pseudogenes are present on chromosomes 5 and 22. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are fertile. Mice homozygous for a gene trapped allele die prior to E6.5 while heterozygous mice are resistant to LPS-induced mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Terf2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01901:Terf2ip APN 8 112012068 missense probably benign
R0244:Terf2ip UTSW 8 112018164 missense possibly damaging 0.73
R0544:Terf2ip UTSW 8 112015342 missense possibly damaging 0.88
R0617:Terf2ip UTSW 8 112011495 missense probably benign 0.10
R0976:Terf2ip UTSW 8 112011717 missense probably damaging 0.98
R1709:Terf2ip UTSW 8 112011606 frame shift probably null
R2078:Terf2ip UTSW 8 112015403 missense probably benign 0.02
R2134:Terf2ip UTSW 8 112011639 missense possibly damaging 0.71
R6172:Terf2ip UTSW 8 112018017 missense probably damaging 1.00
R6266:Terf2ip UTSW 8 112011915 missense probably damaging 1.00
R6563:Terf2ip UTSW 8 112018202 missense probably damaging 1.00
R7180:Terf2ip UTSW 8 112011420 unclassified probably benign
R7203:Terf2ip UTSW 8 112017986 missense probably benign 0.30
R7222:Terf2ip UTSW 8 112011915 missense possibly damaging 0.64
R7304:Terf2ip UTSW 8 112011648 missense possibly damaging 0.86
R7787:Terf2ip UTSW 8 112015455 missense probably damaging 0.96
R7938:Terf2ip UTSW 8 112012085 missense possibly damaging 0.87
R8089:Terf2ip UTSW 8 112011792 missense probably benign 0.21
R8969:Terf2ip UTSW 8 112011738 missense probably damaging 0.98
R9376:Terf2ip UTSW 8 112011882 missense probably damaging 0.98
R9376:Terf2ip UTSW 8 112017896 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGATCGCAACGAGAAGCTG -3'
(R):5'- AAAAGACGCTCGCTGACAG -3'

Sequencing Primer
(F):5'- TGGACCTGGAGGCCTATC -3'
(R):5'- GCTCGCTGACAGGCAGG -3'
Posted On 2015-09-24