Incidental Mutation 'R4572:Rab4a'
ID 342199
Institutional Source Beutler Lab
Gene Symbol Rab4a
Ensembl Gene ENSMUSG00000019478
Gene Name RAB4A, member RAS oncogene family
Synonyms Rab4
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4572 (G1)
Quality Score 196
Status Validated
Chromosome 8
Chromosomal Location 123805985-123835287 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123834060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 196 (D196V)
Ref Sequence ENSEMBL: ENSMUSP00000113886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117702] [ENSMUST00000118535] [ENSMUST00000127664] [ENSMUST00000212846]
AlphaFold P56371
Predicted Effect probably benign
Transcript: ENSMUST00000117702
AA Change: D196V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113401
Gene: ENSMUSG00000019478
AA Change: D196V

DomainStartEndE-ValueType
RAB 14 177 1.17e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118535
AA Change: D196V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113886
Gene: ENSMUSG00000019478
AA Change: D196V

DomainStartEndE-ValueType
RAB 14 177 1.17e-102 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138442
Predicted Effect probably benign
Transcript: ENSMUST00000212846
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the largest group in the Ras superfamily of small GTPases, which regulate membrane trafficking. The encoded protein is associated with early endosomes and is involved in their sorting and recycling. The protein also plays a role in regulating the recycling of receptors from endosomes to the plasma membrane. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Rab4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Rab4a APN 8 123827414 missense probably damaging 1.00
IGL02553:Rab4a APN 8 123823822 missense probably benign 0.35
R0049:Rab4a UTSW 8 123827342 missense probably damaging 0.99
R0049:Rab4a UTSW 8 123827342 missense probably damaging 0.99
R0613:Rab4a UTSW 8 123823835 missense possibly damaging 0.83
R1828:Rab4a UTSW 8 123823826 missense probably damaging 1.00
R4694:Rab4a UTSW 8 123829030 missense probably damaging 1.00
R5288:Rab4a UTSW 8 123827374 missense probably benign 0.02
R6994:Rab4a UTSW 8 123830366 missense probably damaging 0.99
R7129:Rab4a UTSW 8 123827330 missense probably benign 0.03
R7849:Rab4a UTSW 8 123806137 start codon destroyed probably null 0.04
R8073:Rab4a UTSW 8 123827396 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- CCTGTGCACATGTGTTACAC -3'
(R):5'- TGACTATTCCTAAGGGCCTCTC -3'

Sequencing Primer
(F):5'- CTATACTCAAGGCCAGTCTGG -3'
(R):5'- AAGGGCCTCTCCTCCCC -3'
Posted On 2015-09-24