Incidental Mutation 'R4572:Sesn3'
ID 342200
Institutional Source Beutler Lab
Gene Symbol Sesn3
Ensembl Gene ENSMUSG00000032009
Gene Name sestrin 3
Synonyms 5630400E15Rik, SEST3
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 14275067-14333101 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 14321220 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 263 (R263H)
Ref Sequence ENSEMBL: ENSMUSP00000146784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034507] [ENSMUST00000208222] [ENSMUST00000209187]
AlphaFold Q9CYP7
Predicted Effect probably benign
Transcript: ENSMUST00000034507
AA Change: R324H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034507
Gene: ENSMUSG00000032009
AA Change: R324H

DomainStartEndE-ValueType
low complexity region 6 12 N/A INTRINSIC
Pfam:PA26 39 491 8.4e-204 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208142
Predicted Effect probably benign
Transcript: ENSMUST00000208222
AA Change: R402H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209145
Predicted Effect probably benign
Transcript: ENSMUST00000209187
AA Change: R263H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.8565 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sestrin family of stress-induced proteins. The encoded protein reduces the levels of intracellular reactive oxygen species induced by activated Ras downstream of RAC-alpha serine/threonine-protein kinase (Akt) and FoxO transcription factor. The protein is required for normal regulation of blood glucose, insulin resistance and plays a role in lipid storage in obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: When fed a high fat diet, mice homozygous for a gene trap allele exhibit impaired glucose tolerance, insulin resistance, reduced hepatic glucose production, impaired adipocyte glucose uptake, increased hepatic steatosis, and decreased mitochondria in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Sesn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Sesn3 APN 9 14321142 missense probably damaging 1.00
IGL01396:Sesn3 APN 9 14321078 missense probably benign 0.43
IGL01925:Sesn3 APN 9 14320400 missense probably damaging 1.00
IGL02016:Sesn3 APN 9 14320337 missense probably damaging 1.00
IGL02498:Sesn3 APN 9 14306268 splice site probably benign
IGL02892:Sesn3 APN 9 14314734 critical splice donor site probably null
IGL02933:Sesn3 APN 9 14321208 missense probably damaging 1.00
IGL03112:Sesn3 APN 9 14310261 missense probably damaging 1.00
R0591:Sesn3 UTSW 9 14308558 missense probably damaging 0.96
R1450:Sesn3 UTSW 9 14316224 missense possibly damaging 0.80
R1495:Sesn3 UTSW 9 14308521 missense probably damaging 0.98
R1897:Sesn3 UTSW 9 14308645 missense probably damaging 1.00
R2237:Sesn3 UTSW 9 14308465 missense probably benign
R2238:Sesn3 UTSW 9 14308465 missense probably benign
R4209:Sesn3 UTSW 9 14306209 missense probably benign 0.12
R4352:Sesn3 UTSW 9 14320373 missense probably damaging 0.99
R4535:Sesn3 UTSW 9 14322658 missense probably benign 0.05
R6261:Sesn3 UTSW 9 14321163 missense probably benign 0.27
R6304:Sesn3 UTSW 9 14322561 critical splice acceptor site probably null
R6556:Sesn3 UTSW 9 14321253 missense possibly damaging 0.95
R6741:Sesn3 UTSW 9 14320340 missense possibly damaging 0.72
R6906:Sesn3 UTSW 9 14325641 missense probably damaging 0.98
R6988:Sesn3 UTSW 9 14310257 nonsense probably null
R7289:Sesn3 UTSW 9 14276552 start codon destroyed probably benign
R7318:Sesn3 UTSW 9 14308577 missense probably damaging 0.96
R7646:Sesn3 UTSW 9 14308615 missense probably damaging 1.00
R8768:Sesn3 UTSW 9 14314668 missense probably damaging 1.00
R8823:Sesn3 UTSW 9 14310240 intron probably benign
R8923:Sesn3 UTSW 9 14306266 critical splice donor site probably null
R9336:Sesn3 UTSW 9 14314554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACGTTTTCCTACATCCAG -3'
(R):5'- ATCATTCACTTTCATGGCCATGTAC -3'

Sequencing Primer
(F):5'- ACGTTTTCCTACATCCAGGACTACAC -3'
(R):5'- CTGCACAGTGAACATACC -3'
Posted On 2015-09-24