Mutagenetix > Incidental Mutation

Incidental Mutation 'R4572:Sesn3'

342200

Institutional Source

Beutler Lab

Gene Symbol

Sesn3

Ensembl Gene

ENSMUSG00000032009

Gene Name

sestrin 3

Synonyms

5630400E15Rik, SEST3

MMRRC Submission

041796-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14275067-14333101 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14321220 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 263 (R263H)

Ref Sequence

ENSEMBL: ENSMUSP00000146784 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034507] [ENSMUST00000208222] [ENSMUST00000209187]

AlphaFold

Q9CYP7

Predicted Effect

probably benign
Transcript: ENSMUST00000034507
AA Change: R324H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000034507
Gene: ENSMUSG00000032009
AA Change: R324H

Domain	Start	End	E-Value	Type
low complexity region	6	12	N/A	INTRINSIC
Pfam:PA26	39	491	8.4e-204	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208142

Predicted Effect

probably benign
Transcript: ENSMUST00000208222
AA Change: R402H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209106

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209145

Predicted Effect

probably benign
Transcript: ENSMUST00000209187
AA Change: R263H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.8565

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sestrin family of stress-induced proteins. The encoded protein reduces the levels of intracellular reactive oxygen species induced by activated Ras downstream of RAC-alpha serine/threonine-protein kinase (Akt) and FoxO transcription factor. The protein is required for normal regulation of blood glucose, insulin resistance and plays a role in lipid storage in obesity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
PHENOTYPE: When fed a high fat diet, mice homozygous for a gene trap allele exhibit impaired glucose tolerance, insulin resistance, reduced hepatic glucose production, impaired adipocyte glucose uptake, increased hepatic steatosis, and decreased mitochondria in the liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Sesn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00970:Sesn3	APN	9	14321142	missense	probably damaging	1.00
IGL01396:Sesn3	APN	9	14321078	missense	probably benign	0.43
IGL01925:Sesn3	APN	9	14320400	missense	probably damaging	1.00
IGL02016:Sesn3	APN	9	14320337	missense	probably damaging	1.00
IGL02498:Sesn3	APN	9	14306268	splice site	probably benign
IGL02892:Sesn3	APN	9	14314734	critical splice donor site	probably null
IGL02933:Sesn3	APN	9	14321208	missense	probably damaging	1.00
IGL03112:Sesn3	APN	9	14310261	missense	probably damaging	1.00
R0591:Sesn3	UTSW	9	14308558	missense	probably damaging	0.96
R1450:Sesn3	UTSW	9	14316224	missense	possibly damaging	0.80
R1495:Sesn3	UTSW	9	14308521	missense	probably damaging	0.98
R1897:Sesn3	UTSW	9	14308645	missense	probably damaging	1.00
R2237:Sesn3	UTSW	9	14308465	missense	probably benign
R2238:Sesn3	UTSW	9	14308465	missense	probably benign
R4209:Sesn3	UTSW	9	14306209	missense	probably benign	0.12
R4352:Sesn3	UTSW	9	14320373	missense	probably damaging	0.99
R4535:Sesn3	UTSW	9	14322658	missense	probably benign	0.05
R6261:Sesn3	UTSW	9	14321163	missense	probably benign	0.27
R6304:Sesn3	UTSW	9	14322561	critical splice acceptor site	probably null
R6556:Sesn3	UTSW	9	14321253	missense	possibly damaging	0.95
R6741:Sesn3	UTSW	9	14320340	missense	possibly damaging	0.72
R6906:Sesn3	UTSW	9	14325641	missense	probably damaging	0.98
R6988:Sesn3	UTSW	9	14310257	nonsense	probably null
R7289:Sesn3	UTSW	9	14276552	start codon destroyed	probably benign
R7318:Sesn3	UTSW	9	14308577	missense	probably damaging	0.96
R7646:Sesn3	UTSW	9	14308615	missense	probably damaging	1.00
R8768:Sesn3	UTSW	9	14314668	missense	probably damaging	1.00
R8823:Sesn3	UTSW	9	14310240	intron	probably benign
R8923:Sesn3	UTSW	9	14306266	critical splice donor site	probably null
R9336:Sesn3	UTSW	9	14314554	missense	probably damaging	1.00
R9647:Sesn3	UTSW	9	14314703	missense	probably benign	0.12

Predicted Primers

PCR Primer
(F):5'- GCACACGTTTTCCTACATCCAG -3'
(R):5'- ATCATTCACTTTCATGGCCATGTAC -3'

Sequencing Primer
(F):5'- ACGTTTTCCTACATCCAGGACTACAC -3'
(R):5'- CTGCACAGTGAACATACC -3'

Posted On

2015-09-24