Incidental Mutation 'R4572:Olfr862'
ID 342201
Institutional Source Beutler Lab
Gene Symbol Olfr862
Ensembl Gene ENSMUSG00000063842
Gene Name olfactory receptor 862
Synonyms GA_x6K02T2PVTD-13624132-13623212, MOR146-1
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 19882417-19888004 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 19883979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 109 (C109G)
Ref Sequence ENSEMBL: ENSMUSP00000078603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073765] [ENSMUST00000079660]
AlphaFold Q8VFJ1
Predicted Effect probably benign
Transcript: ENSMUST00000073765
AA Change: C109G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073437
Gene: ENSMUSG00000063842
AA Change: C109G

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
Pfam:7tm_4 31 306 3.1e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 282 1.3e-7 PFAM
Pfam:7tm_1 41 290 5.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079660
AA Change: C109G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078603
Gene: ENSMUSG00000063842
AA Change: C109G

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 303 8.3e-8 PFAM
Pfam:7tm_1 41 290 4.5e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Olfr862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Olfr862 APN 9 19883548 nonsense probably null
IGL01636:Olfr862 APN 9 19884188 missense probably benign 0.14
IGL01765:Olfr862 APN 9 19883951 missense possibly damaging 0.71
IGL01967:Olfr862 APN 9 19883589 missense probably damaging 0.97
IGL03145:Olfr862 APN 9 19883439 missense possibly damaging 0.93
IGL03222:Olfr862 APN 9 19884199 nonsense probably null
R0117:Olfr862 UTSW 9 19884299 missense probably damaging 0.96
R0662:Olfr862 UTSW 9 19883952 missense probably benign 0.32
R2399:Olfr862 UTSW 9 19883924 missense probably damaging 0.98
R4224:Olfr862 UTSW 9 19883600 missense probably benign 0.44
R5607:Olfr862 UTSW 9 19883976 missense probably benign 0.16
R5741:Olfr862 UTSW 9 19883561 missense possibly damaging 0.92
R5759:Olfr862 UTSW 9 19884188 missense probably benign 0.14
R6237:Olfr862 UTSW 9 19884069 missense probably damaging 1.00
R6434:Olfr862 UTSW 9 19883845 nonsense probably null
R7075:Olfr862 UTSW 9 19884063 missense probably benign 0.16
R7534:Olfr862 UTSW 9 19884176 missense probably benign 0.16
R7735:Olfr862 UTSW 9 19884114 missense probably damaging 0.99
R8415:Olfr862 UTSW 9 19884113 missense possibly damaging 0.95
R9246:Olfr862 UTSW 9 19884390 start gained probably benign
R9438:Olfr862 UTSW 9 19883787
Z1177:Olfr862 UTSW 9 19883667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGGATTTCCATATTAGTGCAG -3'
(R):5'- ACTGTGCTTGGAAATGTGCTC -3'

Sequencing Primer
(F):5'- TTAGTGCAGAATTTTAGTTGTGAAAC -3'
(R):5'- GGAAATGTGCTCATCATCTTGGCC -3'
Posted On 2015-09-24