Incidental Mutation 'R4572:Kri1'
ID 342202
Institutional Source Beutler Lab
Gene Symbol Kri1
Ensembl Gene ENSMUSG00000035047
Gene Name KRI1 homolog
Synonyms
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 21273457-21287969 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21280384 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 187 (F187L)
Ref Sequence ENSEMBL: ENSMUSP00000139184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038671] [ENSMUST00000065005] [ENSMUST00000184326]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000038671
AA Change: F305L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047
AA Change: F305L

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065005
SMART Domains Protein: ENSMUSP00000068450
Gene: ENSMUSG00000002820

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Peptidase_C54 109 411 5.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183912
Predicted Effect probably damaging
Transcript: ENSMUST00000184326
AA Change: F187L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047
AA Change: F187L

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192279
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene overlaps with the gene for cysteine endopeptidase AUT-like 4 in a head-to-tail orientation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Kri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Kri1 APN 9 21280427 missense probably damaging 1.00
IGL02272:Kri1 APN 9 21276168 missense probably damaging 1.00
IGL03229:Kri1 APN 9 21282070 missense probably damaging 1.00
FR4548:Kri1 UTSW 9 21281050 small deletion probably benign
R0040:Kri1 UTSW 9 21281105 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0054:Kri1 UTSW 9 21275365 missense probably damaging 1.00
R0284:Kri1 UTSW 9 21276552 splice site probably benign
R0665:Kri1 UTSW 9 21281640 intron probably benign
R1632:Kri1 UTSW 9 21282211 missense possibly damaging 0.89
R1640:Kri1 UTSW 9 21280457 missense possibly damaging 0.61
R1847:Kri1 UTSW 9 21280492 splice site probably benign
R3154:Kri1 UTSW 9 21281894 missense possibly damaging 0.51
R4222:Kri1 UTSW 9 21281063 missense probably benign 0.00
R4905:Kri1 UTSW 9 21287702 missense probably benign 0.19
R5236:Kri1 UTSW 9 21275941 missense probably damaging 1.00
R5539:Kri1 UTSW 9 21279372 nonsense probably null
R5696:Kri1 UTSW 9 21280237 missense probably damaging 1.00
R5701:Kri1 UTSW 9 21281129 missense possibly damaging 0.89
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6031:Kri1 UTSW 9 21275269 missense probably benign 0.03
R6991:Kri1 UTSW 9 21287754 unclassified probably benign
R6994:Kri1 UTSW 9 21287787 unclassified probably benign
R7095:Kri1 UTSW 9 21279432 missense
R7339:Kri1 UTSW 9 21286587 missense
R7652:Kri1 UTSW 9 21281056 small deletion probably benign
R7787:Kri1 UTSW 9 21281084 missense
R7908:Kri1 UTSW 9 21281056 small deletion probably benign
R8781:Kri1 UTSW 9 21280452 missense
R9140:Kri1 UTSW 9 21276138 missense
RF027:Kri1 UTSW 9 21281068 frame shift probably null
RF028:Kri1 UTSW 9 21281071 frame shift probably null
RF058:Kri1 UTSW 9 21281066 frame shift probably null
Z1088:Kri1 UTSW 9 21274122 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTTTGCGGCGCACAGATG -3'
(R):5'- ACATTCACCTCTTTGCAGGG -3'

Sequencing Primer
(F):5'- CACAGATGATGCGATGCTTC -3'
(R):5'- CATAGTGTCGAACTCAGGCTCTAG -3'
Posted On 2015-09-24