Incidental Mutation 'R4572:Ulk4'
ID 342205
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Name unc-51-like kinase 4
Synonyms 4932415A06Rik
MMRRC Submission 041796-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.701) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 120793520-121115225 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121021830 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 627 (K627R)
Ref Sequence ENSEMBL: ENSMUSP00000131342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000051479
AA Change: K627R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: K627R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164969
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably damaging
Transcript: ENSMUST00000171061
AA Change: K627R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: K627R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171923
AA Change: K627R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: K627R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Meta Mutation Damage Score 0.2516 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,107,374 (GRCm39) I747N probably benign Het
Adamtsl2 A G 2: 26,973,268 (GRCm39) Y97C probably damaging Het
Alox12e A G 11: 70,212,007 (GRCm39) probably benign Het
Alpk2 A T 18: 65,414,075 (GRCm39) S2014T probably damaging Het
Ankrd36 A T 11: 5,639,340 (GRCm39) probably null Het
Apobec1 T C 6: 122,558,356 (GRCm39) D133G probably damaging Het
Arfgef1 A T 1: 10,283,366 (GRCm39) I181N probably damaging Het
Cilp2 A G 8: 70,335,060 (GRCm39) V646A probably damaging Het
Clasrp A G 7: 19,318,389 (GRCm39) probably null Het
Cnot2 T C 10: 116,330,751 (GRCm39) T423A probably benign Het
Crtap T C 9: 114,213,874 (GRCm39) D227G probably benign Het
Cyp17a1 A G 19: 46,658,990 (GRCm39) F217S probably damaging Het
Ddx60 A G 8: 62,440,455 (GRCm39) M1036V probably damaging Het
Dnah11 A T 12: 117,973,860 (GRCm39) I2818N probably benign Het
Dok6 T A 18: 89,492,071 (GRCm39) I169F possibly damaging Het
Duox2 T A 2: 122,112,207 (GRCm39) R1326S probably benign Het
Epha10 A G 4: 124,796,361 (GRCm39) T357A unknown Het
Ephb2 A C 4: 136,383,251 (GRCm39) F942C probably damaging Het
Fscn3 T A 6: 28,430,634 (GRCm39) probably null Het
Gabrb2 A G 11: 42,484,744 (GRCm39) N267S possibly damaging Het
Gabrr3 A T 16: 59,282,001 (GRCm39) Y452F probably benign Het
Gen1 A G 12: 11,292,419 (GRCm39) S457P probably damaging Het
Gm1993 C T X: 25,515,656 (GRCm39) R77H probably damaging Het
Gm5592 G A 7: 40,865,583 (GRCm39) probably benign Het
Hmbox1 A G 14: 65,140,682 (GRCm39) probably null Het
Hus1 A T 11: 8,957,617 (GRCm39) probably null Het
Ino80 G A 2: 119,232,839 (GRCm39) R1160W probably damaging Het
Kalrn A T 16: 34,212,412 (GRCm39) F27L probably damaging Het
Kri1 A T 9: 21,191,680 (GRCm39) F187L probably damaging Het
Lekr1 A T 3: 65,691,336 (GRCm39) noncoding transcript Het
Mapk15 T C 15: 75,870,599 (GRCm39) probably benign Het
Mrgpre G A 7: 143,334,841 (GRCm39) L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 (GRCm39) S91T possibly damaging Het
Muc4 T C 16: 32,753,802 (GRCm38) I1226T probably benign Het
Mup15 A G 4: 61,356,454 (GRCm39) probably null Het
Ncapd3 A G 9: 27,005,911 (GRCm39) D1469G probably damaging Het
Nlrp9b G A 7: 19,760,606 (GRCm39) probably null Het
Npy6r A T 18: 44,408,984 (GRCm39) Y135F probably benign Het
Or7e170 A C 9: 19,795,275 (GRCm39) C109G probably benign Het
Phf14 G A 6: 12,006,823 (GRCm39) R825Q probably damaging Het
Pigg A G 5: 108,480,751 (GRCm39) M379V probably benign Het
Plppr3 T A 10: 79,701,897 (GRCm39) Q315L probably benign Het
Plxnd1 C A 6: 115,932,717 (GRCm39) C1921F probably damaging Het
Ptger4 A C 15: 5,272,614 (GRCm39) S2A probably benign Het
Qrfprl A T 6: 65,431,975 (GRCm39) M293L probably benign Het
Rab4a A T 8: 124,560,799 (GRCm39) D196V probably benign Het
Rbck1 G A 2: 152,160,653 (GRCm39) Q428* probably null Het
Rgs14 A T 13: 55,527,875 (GRCm39) N266I probably damaging Het
Serpina1c A T 12: 103,864,967 (GRCm39) probably benign Het
Sesn3 G A 9: 14,232,516 (GRCm39) R263H probably benign Het
Slfn1 A T 11: 83,012,289 (GRCm39) D135V probably benign Het
Spata17 T C 1: 186,926,193 (GRCm39) K46E possibly damaging Het
Srcin1 A C 11: 97,425,760 (GRCm39) D432E probably damaging Het
Stxbp5 T C 10: 9,713,888 (GRCm39) E217G probably damaging Het
Terf2ip A G 8: 112,738,649 (GRCm39) D179G probably damaging Het
Tll1 A G 8: 64,509,343 (GRCm39) F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,224,461 (GRCm39) probably null Het
Trappc9 G T 15: 72,808,916 (GRCm39) Q537K possibly damaging Het
Trim30a G T 7: 104,060,395 (GRCm39) C460* probably null Het
Trim35 T C 14: 66,545,322 (GRCm39) Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,479 (GRCm39) H209Q probably benign Het
Wnk1 T C 6: 119,928,872 (GRCm39) T1319A possibly damaging Het
Wnt9b G A 11: 103,622,981 (GRCm39) R141C probably damaging Het
Zfp735 A G 11: 73,580,611 (GRCm39) M37V probably benign Het
Zmym1 A T 4: 126,944,628 (GRCm39) N186K probably benign Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 120,997,358 (GRCm39) missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121,037,228 (GRCm39) missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121,095,367 (GRCm39) missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121,084,251 (GRCm39) missense probably damaging 1.00
IGL02139:Ulk4 APN 9 120,970,897 (GRCm39) splice site probably null
IGL02266:Ulk4 APN 9 120,910,766 (GRCm39) missense probably benign 0.10
IGL02511:Ulk4 APN 9 121,017,420 (GRCm39) missense probably damaging 1.00
IGL02546:Ulk4 APN 9 120,981,373 (GRCm39) nonsense probably null
IGL02687:Ulk4 APN 9 121,021,728 (GRCm39) missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 120,974,402 (GRCm39) missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121,084,237 (GRCm39) missense probably benign 0.02
R0031:Ulk4 UTSW 9 121,102,048 (GRCm39) missense probably damaging 1.00
R0433:Ulk4 UTSW 9 120,873,885 (GRCm39) missense probably benign 0.27
R0513:Ulk4 UTSW 9 120,981,391 (GRCm39) missense probably benign 0.13
R0524:Ulk4 UTSW 9 121,081,717 (GRCm39) critical splice donor site probably null
R1268:Ulk4 UTSW 9 121,086,140 (GRCm39) splice site probably benign
R1439:Ulk4 UTSW 9 121,095,324 (GRCm39) missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1470:Ulk4 UTSW 9 120,910,722 (GRCm39) missense probably benign 0.00
R1531:Ulk4 UTSW 9 120,873,841 (GRCm39) missense probably damaging 0.97
R1595:Ulk4 UTSW 9 120,873,904 (GRCm39) missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121,033,871 (GRCm39) missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 120,997,250 (GRCm39) missense probably null 1.00
R1966:Ulk4 UTSW 9 121,086,182 (GRCm39) missense probably benign
R2129:Ulk4 UTSW 9 120,981,248 (GRCm39) missense probably benign 0.03
R2329:Ulk4 UTSW 9 121,101,953 (GRCm39) missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R2878:Ulk4 UTSW 9 121,089,105 (GRCm39) missense probably benign 0.11
R3734:Ulk4 UTSW 9 121,091,055 (GRCm39) missense probably benign 0.21
R3769:Ulk4 UTSW 9 121,092,766 (GRCm39) missense probably benign 0.00
R4005:Ulk4 UTSW 9 120,997,265 (GRCm39) missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 120,873,915 (GRCm39) missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 120,903,062 (GRCm39) missense probably benign 0.00
R4461:Ulk4 UTSW 9 120,985,950 (GRCm39) missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4542:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4647:Ulk4 UTSW 9 120,970,918 (GRCm39) missense probably benign 0.15
R4712:Ulk4 UTSW 9 121,073,436 (GRCm39) missense probably benign 0.23
R4730:Ulk4 UTSW 9 121,092,791 (GRCm39) missense probably benign 0.05
R4731:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4732:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4733:Ulk4 UTSW 9 121,092,704 (GRCm39) nonsense probably null
R4737:Ulk4 UTSW 9 120,902,938 (GRCm39) nonsense probably null
R4781:Ulk4 UTSW 9 120,932,642 (GRCm39) missense probably benign 0.00
R4860:Ulk4 UTSW 9 121,079,968 (GRCm39) missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121,087,798 (GRCm39) missense probably benign 0.00
R4990:Ulk4 UTSW 9 121,021,852 (GRCm39) missense probably benign 0.01
R6056:Ulk4 UTSW 9 121,102,021 (GRCm39) missense probably damaging 1.00
R6448:Ulk4 UTSW 9 120,932,696 (GRCm39) missense probably damaging 0.99
R6546:Ulk4 UTSW 9 120,970,960 (GRCm39) missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121,017,408 (GRCm39) missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121,087,886 (GRCm39) missense probably benign
R6929:Ulk4 UTSW 9 120,903,081 (GRCm39) missense probably benign 0.02
R7069:Ulk4 UTSW 9 121,095,583 (GRCm39) missense probably benign 0.25
R7069:Ulk4 UTSW 9 121,087,876 (GRCm39) missense probably benign 0.01
R7293:Ulk4 UTSW 9 121,084,190 (GRCm39) missense probably damaging 1.00
R7299:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7301:Ulk4 UTSW 9 120,974,125 (GRCm39) missense probably benign 0.32
R7337:Ulk4 UTSW 9 121,077,993 (GRCm39) missense probably benign 0.44
R7395:Ulk4 UTSW 9 121,084,178 (GRCm39) missense probably benign
R7423:Ulk4 UTSW 9 120,932,687 (GRCm39) missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 120,970,904 (GRCm39) missense probably benign 0.00
R7753:Ulk4 UTSW 9 121,095,578 (GRCm39) critical splice donor site probably null
R7790:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121,092,734 (GRCm39) missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 120,873,885 (GRCm39) missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121,102,022 (GRCm39) missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121,095,317 (GRCm39) missense probably damaging 0.99
R8203:Ulk4 UTSW 9 120,997,274 (GRCm39) missense probably damaging 0.96
R8246:Ulk4 UTSW 9 120,985,941 (GRCm39) makesense probably null
R8430:Ulk4 UTSW 9 121,086,144 (GRCm39) critical splice donor site probably null
R8841:Ulk4 UTSW 9 121,033,804 (GRCm39) missense probably damaging 1.00
R9014:Ulk4 UTSW 9 121,017,294 (GRCm39) missense probably benign 0.00
R9092:Ulk4 UTSW 9 120,903,003 (GRCm39) missense
R9126:Ulk4 UTSW 9 121,090,988 (GRCm39) missense probably damaging 0.99
R9176:Ulk4 UTSW 9 120,974,128 (GRCm39) missense probably benign
R9235:Ulk4 UTSW 9 120,981,217 (GRCm39) missense probably benign 0.13
R9713:Ulk4 UTSW 9 120,873,862 (GRCm39) nonsense probably null
X0024:Ulk4 UTSW 9 121,021,819 (GRCm39) missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121,091,672 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCCTCAGTCAGAGTGCTCG -3'
(R):5'- GTTTAGTACGCAGAGGGCTG -3'

Sequencing Primer
(F):5'- TCAGTCAGAGTGCTCGAGTCC -3'
(R):5'- AGACCGCTGGCTCCTTGTAG -3'
Posted On 2015-09-24