Mutagenetix > Incidental Mutation

Incidental Mutation 'R4572:Ulk4'

342205

Institutional Source

Beutler Lab

Gene Symbol

Ulk4

Ensembl Gene

ENSMUSG00000040936

Gene Name

unc-51-like kinase 4

Synonyms

4932415A06Rik

MMRRC Submission

041796-MU

Accession Numbers

Genbank: NM_177589; MGI: 1921622

Essential gene?

Possibly essential (E-score: 0.672) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120955351-121277197 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121192764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 627 (K627R)

Ref Sequence

ENSEMBL: ENSMUSP00000131342 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051479
AA Change: K627R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: K627R

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	9.9e-26	PFAM
Pfam:Pkinase	4	280	4.6e-49	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1161	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051565

SMART Domains

Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

Domain	Start	End	E-Value	Type
SCOP:d1jvpp_	1	32	9e-6	SMART
Blast:S_TKc	4	45	2e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164336

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164969

Predicted Effect

probably benign
Transcript: ENSMUST00000170237

Predicted Effect

probably damaging
Transcript: ENSMUST00000171061
AA Change: K627R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: K627R

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	277	4.3e-26	PFAM
Pfam:Pkinase	4	280	2.1e-49	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171923
AA Change: K627R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: K627R

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	4	153	3.1e-14	PFAM
Pfam:Pkinase	4	280	4.9e-50	PFAM
Pfam:Pkinase_Tyr	165	277	6.1e-10	PFAM
low complexity region	949	964	N/A	INTRINSIC
low complexity region	968	985	N/A	INTRINSIC
low complexity region	1107	1119	N/A	INTRINSIC
low complexity region	1147	1171	N/A	INTRINSIC

Meta Mutation Damage Score

0.2516

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Ulk4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01122:Ulk4	APN	9	121168292	missense	possibly damaging	0.48
IGL01345:Ulk4	APN	9	121208162	missense	possibly damaging	0.48
IGL01432:Ulk4	APN	9	121266301	missense	probably damaging	1.00
IGL01807:Ulk4	APN	9	121255185	missense	probably damaging	1.00
IGL02139:Ulk4	APN	9	121141831	splice site	probably null
IGL02266:Ulk4	APN	9	121081700	missense	probably benign	0.10
IGL02511:Ulk4	APN	9	121188354	missense	probably damaging	1.00
IGL02546:Ulk4	APN	9	121152307	nonsense	probably null
IGL02687:Ulk4	APN	9	121192662	missense	possibly damaging	0.89
IGL03220:Ulk4	APN	9	121145336	missense	probably damaging	1.00
3-1:Ulk4	UTSW	9	121255171	missense	probably benign	0.02
R0031:Ulk4	UTSW	9	121272982	missense	probably damaging	1.00
R0433:Ulk4	UTSW	9	121044819	missense	probably benign	0.27
R0513:Ulk4	UTSW	9	121152325	missense	probably benign	0.13
R0524:Ulk4	UTSW	9	121252651	critical splice donor site	probably null
R1268:Ulk4	UTSW	9	121257074	splice site	probably benign
R1439:Ulk4	UTSW	9	121266258	missense	possibly damaging	0.58
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1470:Ulk4	UTSW	9	121081656	missense	probably benign	0.00
R1531:Ulk4	UTSW	9	121044775	missense	probably damaging	0.97
R1595:Ulk4	UTSW	9	121044838	missense	probably damaging	0.96
R1620:Ulk4	UTSW	9	121204805	missense	possibly damaging	0.81
R1835:Ulk4	UTSW	9	121168184	missense	probably null	1.00
R1966:Ulk4	UTSW	9	121257116	missense	probably benign
R2129:Ulk4	UTSW	9	121152182	missense	probably benign	0.03
R2329:Ulk4	UTSW	9	121272887	missense	probably damaging	1.00
R2877:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R2878:Ulk4	UTSW	9	121260039	missense	probably benign	0.11
R3734:Ulk4	UTSW	9	121261989	missense	probably benign	0.21
R3769:Ulk4	UTSW	9	121263700	missense	probably benign	0.00
R4005:Ulk4	UTSW	9	121168199	missense	possibly damaging	0.94
R4024:Ulk4	UTSW	9	121044849	missense	possibly damaging	0.86
R4321:Ulk4	UTSW	9	121073996	missense	probably benign	0.00
R4461:Ulk4	UTSW	9	121156884	missense	possibly damaging	0.83
R4537:Ulk4	UTSW	9	121263638	nonsense	probably null
R4542:Ulk4	UTSW	9	121263638	nonsense	probably null
R4647:Ulk4	UTSW	9	121141852	missense	probably benign	0.15
R4712:Ulk4	UTSW	9	121244370	missense	probably benign	0.23
R4730:Ulk4	UTSW	9	121263725	missense	probably benign	0.05
R4731:Ulk4	UTSW	9	121263638	nonsense	probably null
R4732:Ulk4	UTSW	9	121263638	nonsense	probably null
R4733:Ulk4	UTSW	9	121263638	nonsense	probably null
R4737:Ulk4	UTSW	9	121073872	nonsense	probably null
R4781:Ulk4	UTSW	9	121103576	missense	probably benign	0.00
R4860:Ulk4	UTSW	9	121250902	missense	possibly damaging	0.68
R4926:Ulk4	UTSW	9	121258732	missense	probably benign	0.00
R4990:Ulk4	UTSW	9	121192786	missense	probably benign	0.01
R6056:Ulk4	UTSW	9	121272955	missense	probably damaging	1.00
R6448:Ulk4	UTSW	9	121103630	missense	probably damaging	0.99
R6546:Ulk4	UTSW	9	121141894	missense	probably damaging	1.00
R6668:Ulk4	UTSW	9	121188342	missense	probably damaging	1.00
R6915:Ulk4	UTSW	9	121258820	missense	probably benign
R6929:Ulk4	UTSW	9	121074015	missense	probably benign	0.02
R7069:Ulk4	UTSW	9	121258810	missense	probably benign	0.01
R7069:Ulk4	UTSW	9	121266517	missense	probably benign	0.25
R7293:Ulk4	UTSW	9	121255124	missense	probably damaging	1.00
R7299:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7301:Ulk4	UTSW	9	121145059	missense	probably benign	0.32
R7337:Ulk4	UTSW	9	121248927	missense	probably benign	0.44
R7395:Ulk4	UTSW	9	121255112	missense	probably benign
R7423:Ulk4	UTSW	9	121103621	missense	possibly damaging	0.48
R7545:Ulk4	UTSW	9	121141838	missense	probably benign	0.00
R7753:Ulk4	UTSW	9	121266512	critical splice donor site	probably null
R7790:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7791:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7793:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7834:Ulk4	UTSW	9	121263668	missense	possibly damaging	0.70
R7836:Ulk4	UTSW	9	121044819	missense	possibly damaging	0.72
R7960:Ulk4	UTSW	9	121272956	missense	probably damaging	1.00
R8087:Ulk4	UTSW	9	121266251	missense	probably damaging	0.99
R8203:Ulk4	UTSW	9	121168208	missense	probably damaging	0.96
R8246:Ulk4	UTSW	9	121156875	makesense	probably null
R8430:Ulk4	UTSW	9	121257078	critical splice donor site	probably null
R8841:Ulk4	UTSW	9	121204738	missense	probably damaging	1.00
R9014:Ulk4	UTSW	9	121188228	missense	probably benign	0.00
R9092:Ulk4	UTSW	9	121073937	missense
R9126:Ulk4	UTSW	9	121261922	missense	probably damaging	0.99
R9176:Ulk4	UTSW	9	121145062	missense	probably benign
R9235:Ulk4	UTSW	9	121152151	missense	probably benign	0.13
R9713:Ulk4	UTSW	9	121044796	nonsense	probably null
X0024:Ulk4	UTSW	9	121192753	missense	probably damaging	1.00
X0066:Ulk4	UTSW	9	121262606	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCCTCAGTCAGAGTGCTCG -3'
(R):5'- GTTTAGTACGCAGAGGGCTG -3'

Sequencing Primer
(F):5'- TCAGTCAGAGTGCTCGAGTCC -3'
(R):5'- AGACCGCTGGCTCCTTGTAG -3'

Posted On

2015-09-24