Incidental Mutation 'R4572:Stxbp5'
ID 342206
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Name syntaxin binding protein 5 (tomosyn)
Synonyms LGL3, tomosyn 1, 0710001E20Rik, 4930565N16Rik
MMRRC Submission 041796-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 9631291-9776823 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9713888 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 217 (E217G)
Ref Sequence ENSEMBL: ENSMUSP00000121507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
AlphaFold Q8K400
Predicted Effect possibly damaging
Transcript: ENSMUST00000038213
AA Change: E217G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: E217G

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000125200
AA Change: E217G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: E217G

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000141722
AA Change: E217G

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: E217G

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Meta Mutation Damage Score 0.2563 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,107,374 (GRCm39) I747N probably benign Het
Adamtsl2 A G 2: 26,973,268 (GRCm39) Y97C probably damaging Het
Alox12e A G 11: 70,212,007 (GRCm39) probably benign Het
Alpk2 A T 18: 65,414,075 (GRCm39) S2014T probably damaging Het
Ankrd36 A T 11: 5,639,340 (GRCm39) probably null Het
Apobec1 T C 6: 122,558,356 (GRCm39) D133G probably damaging Het
Arfgef1 A T 1: 10,283,366 (GRCm39) I181N probably damaging Het
Cilp2 A G 8: 70,335,060 (GRCm39) V646A probably damaging Het
Clasrp A G 7: 19,318,389 (GRCm39) probably null Het
Cnot2 T C 10: 116,330,751 (GRCm39) T423A probably benign Het
Crtap T C 9: 114,213,874 (GRCm39) D227G probably benign Het
Cyp17a1 A G 19: 46,658,990 (GRCm39) F217S probably damaging Het
Ddx60 A G 8: 62,440,455 (GRCm39) M1036V probably damaging Het
Dnah11 A T 12: 117,973,860 (GRCm39) I2818N probably benign Het
Dok6 T A 18: 89,492,071 (GRCm39) I169F possibly damaging Het
Duox2 T A 2: 122,112,207 (GRCm39) R1326S probably benign Het
Epha10 A G 4: 124,796,361 (GRCm39) T357A unknown Het
Ephb2 A C 4: 136,383,251 (GRCm39) F942C probably damaging Het
Fscn3 T A 6: 28,430,634 (GRCm39) probably null Het
Gabrb2 A G 11: 42,484,744 (GRCm39) N267S possibly damaging Het
Gabrr3 A T 16: 59,282,001 (GRCm39) Y452F probably benign Het
Gen1 A G 12: 11,292,419 (GRCm39) S457P probably damaging Het
Gm1993 C T X: 25,515,656 (GRCm39) R77H probably damaging Het
Gm5592 G A 7: 40,865,583 (GRCm39) probably benign Het
Hmbox1 A G 14: 65,140,682 (GRCm39) probably null Het
Hus1 A T 11: 8,957,617 (GRCm39) probably null Het
Ino80 G A 2: 119,232,839 (GRCm39) R1160W probably damaging Het
Kalrn A T 16: 34,212,412 (GRCm39) F27L probably damaging Het
Kri1 A T 9: 21,191,680 (GRCm39) F187L probably damaging Het
Lekr1 A T 3: 65,691,336 (GRCm39) noncoding transcript Het
Mapk15 T C 15: 75,870,599 (GRCm39) probably benign Het
Mrgpre G A 7: 143,334,841 (GRCm39) L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 (GRCm39) S91T possibly damaging Het
Muc4 T C 16: 32,753,802 (GRCm38) I1226T probably benign Het
Mup15 A G 4: 61,356,454 (GRCm39) probably null Het
Ncapd3 A G 9: 27,005,911 (GRCm39) D1469G probably damaging Het
Nlrp9b G A 7: 19,760,606 (GRCm39) probably null Het
Npy6r A T 18: 44,408,984 (GRCm39) Y135F probably benign Het
Or7e170 A C 9: 19,795,275 (GRCm39) C109G probably benign Het
Phf14 G A 6: 12,006,823 (GRCm39) R825Q probably damaging Het
Pigg A G 5: 108,480,751 (GRCm39) M379V probably benign Het
Plppr3 T A 10: 79,701,897 (GRCm39) Q315L probably benign Het
Plxnd1 C A 6: 115,932,717 (GRCm39) C1921F probably damaging Het
Ptger4 A C 15: 5,272,614 (GRCm39) S2A probably benign Het
Qrfprl A T 6: 65,431,975 (GRCm39) M293L probably benign Het
Rab4a A T 8: 124,560,799 (GRCm39) D196V probably benign Het
Rbck1 G A 2: 152,160,653 (GRCm39) Q428* probably null Het
Rgs14 A T 13: 55,527,875 (GRCm39) N266I probably damaging Het
Serpina1c A T 12: 103,864,967 (GRCm39) probably benign Het
Sesn3 G A 9: 14,232,516 (GRCm39) R263H probably benign Het
Slfn1 A T 11: 83,012,289 (GRCm39) D135V probably benign Het
Spata17 T C 1: 186,926,193 (GRCm39) K46E possibly damaging Het
Srcin1 A C 11: 97,425,760 (GRCm39) D432E probably damaging Het
Terf2ip A G 8: 112,738,649 (GRCm39) D179G probably damaging Het
Tll1 A G 8: 64,509,343 (GRCm39) F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,224,461 (GRCm39) probably null Het
Trappc9 G T 15: 72,808,916 (GRCm39) Q537K possibly damaging Het
Trim30a G T 7: 104,060,395 (GRCm39) C460* probably null Het
Trim35 T C 14: 66,545,322 (GRCm39) Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,479 (GRCm39) H209Q probably benign Het
Ulk4 T C 9: 121,021,830 (GRCm39) K627R probably damaging Het
Wnk1 T C 6: 119,928,872 (GRCm39) T1319A possibly damaging Het
Wnt9b G A 11: 103,622,981 (GRCm39) R141C probably damaging Het
Zfp735 A G 11: 73,580,611 (GRCm39) M37V probably benign Het
Zmym1 A T 4: 126,944,628 (GRCm39) N186K probably benign Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9,675,694 (GRCm39) missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9,684,346 (GRCm39) splice site probably benign
IGL01725:Stxbp5 APN 10 9,693,155 (GRCm39) missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9,638,565 (GRCm39) missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9,692,041 (GRCm39) missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9,638,700 (GRCm39) nonsense probably null
IGL02720:Stxbp5 APN 10 9,665,105 (GRCm39) critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9,692,034 (GRCm39) missense probably null 1.00
IGL03288:Stxbp5 APN 10 9,742,447 (GRCm39) splice site probably null
Fatty_fish UTSW 10 9,646,295 (GRCm39) missense probably damaging 1.00
reindeer UTSW 10 9,713,836 (GRCm39) missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9,645,187 (GRCm39) missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9,693,048 (GRCm39) critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9,638,492 (GRCm39) missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9,638,492 (GRCm39) missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9,646,272 (GRCm39) missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9,742,442 (GRCm39) splice site probably benign
R0631:Stxbp5 UTSW 10 9,660,102 (GRCm39) missense probably benign
R0723:Stxbp5 UTSW 10 9,644,617 (GRCm39) missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9,740,843 (GRCm39) missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9,740,843 (GRCm39) missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9,684,784 (GRCm39) missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9,688,135 (GRCm39) missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9,692,013 (GRCm39) missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9,713,836 (GRCm39) missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9,711,590 (GRCm39) missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9,644,671 (GRCm39) missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9,645,163 (GRCm39) missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9,665,060 (GRCm39) intron probably benign
R4764:Stxbp5 UTSW 10 9,646,367 (GRCm39) missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9,638,635 (GRCm39) missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9,638,635 (GRCm39) missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9,688,085 (GRCm39) nonsense probably null
R4887:Stxbp5 UTSW 10 9,684,844 (GRCm39) missense probably benign
R4930:Stxbp5 UTSW 10 9,636,610 (GRCm39) utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9,646,295 (GRCm39) missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9,674,019 (GRCm39) critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9,675,735 (GRCm39) missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9,684,252 (GRCm39) missense probably benign
R5531:Stxbp5 UTSW 10 9,638,668 (GRCm39) nonsense probably null
R5605:Stxbp5 UTSW 10 9,645,490 (GRCm39) intron probably benign
R5614:Stxbp5 UTSW 10 9,636,638 (GRCm39) utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9,776,330 (GRCm39) missense probably benign
R5990:Stxbp5 UTSW 10 9,711,677 (GRCm39) missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9,675,772 (GRCm39) missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9,646,430 (GRCm39) missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9,684,216 (GRCm39) missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9,693,083 (GRCm39) missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9,642,931 (GRCm39) missense probably damaging 1.00
R6284:Stxbp5 UTSW 10 9,642,923 (GRCm39) missense probably benign 0.32
R6394:Stxbp5 UTSW 10 9,774,975 (GRCm39) nonsense probably null
R6427:Stxbp5 UTSW 10 9,774,998 (GRCm39) missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9,660,105 (GRCm39) missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9,673,931 (GRCm39) missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9,684,874 (GRCm39) missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9,645,154 (GRCm39) missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9,684,248 (GRCm39) missense probably benign
R7974:Stxbp5 UTSW 10 9,646,439 (GRCm39) splice site probably null
R8009:Stxbp5 UTSW 10 9,692,046 (GRCm39) missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9,660,129 (GRCm39) missense probably benign
R8353:Stxbp5 UTSW 10 9,684,792 (GRCm39) missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9,688,003 (GRCm39) critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9,684,792 (GRCm39) missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9,688,033 (GRCm39) missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9,693,050 (GRCm39) missense probably null 0.98
R8805:Stxbp5 UTSW 10 9,713,859 (GRCm39) nonsense probably null
R9172:Stxbp5 UTSW 10 9,645,152 (GRCm39) missense possibly damaging 0.94
R9472:Stxbp5 UTSW 10 9,719,101 (GRCm39) missense probably damaging 1.00
R9513:Stxbp5 UTSW 10 9,687,754 (GRCm39) missense probably benign 0.17
R9649:Stxbp5 UTSW 10 9,774,938 (GRCm39) missense probably damaging 0.96
X0020:Stxbp5 UTSW 10 9,638,634 (GRCm39) missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9,776,289 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AGGCTTTGTTTCAGTGGAATCC -3'
(R):5'- TGCAGATCTGTCCTGCTGTG -3'

Sequencing Primer
(F):5'- TTCAGTGGAATCCGAAAAACTTCCG -3'
(R):5'- AGATCTGTCCTGCTGTGTTCTCG -3'
Posted On 2015-09-24