Mutagenetix > Incidental Mutations

Incidental Mutation 'R4572:Stxbp5'

342206

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5

Ensembl Gene

ENSMUSG00000019790

Gene Name

syntaxin binding protein 5 (tomosyn)

Synonyms

4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1

MMRRC Submission

041796-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

9755547-9901079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 9838144 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 217 (E217G)

Ref Sequence

ENSEMBL: ENSMUSP00000121507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038213
AA Change: E217G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: E217G

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	276	385	2e-36	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
Pfam:Lgl_C	771	1050	2.7e-8	PFAM
PDB:1URQ\|A	1086	1145	2e-33	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000125200
AA Change: E217G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: E217G

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.6e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	722	730	N/A	INTRINSIC
Pfam:Lgl_C	839	994	1.9e-8	PFAM
PDB:1URQ\|A	1033	1092	2e-33	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141722
AA Change: E217G

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: E217G

Domain	Start	End	E-Value	Type
low complexity region	17	28	N/A	INTRINSIC
WD40	46	86	2.21e1	SMART
WD40	88	127	5.94e0	SMART
WD40	132	171	1.97e2	SMART
WD40	185	225	1.99e0	SMART
WD40	228	266	5.69e-4	SMART
Pfam:LLGL	273	385	1.7e-46	PFAM
WD40	386	465	2.88e-1	SMART
WD40	491	530	3.68e1	SMART
low complexity region	572	591	N/A	INTRINSIC
low complexity region	739	747	N/A	INTRINSIC
Pfam:Lgl_C	856	1011	2e-8	PFAM
PDB:1URQ\|A	1050	1109	2e-33	PDB

Meta Mutation Damage Score

0.2563

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Stxbp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Stxbp5	APN	10	9799950	missense	probably damaging	1.00
IGL00950:Stxbp5	APN	10	9808602	splice site	probably benign
IGL01725:Stxbp5	APN	10	9817411	missense	probably damaging	1.00
IGL02150:Stxbp5	APN	10	9762821	missense	probably damaging	1.00
IGL02339:Stxbp5	APN	10	9816297	missense	possibly damaging	0.89
IGL02697:Stxbp5	APN	10	9762956	nonsense	probably null
IGL02720:Stxbp5	APN	10	9789361	critical splice donor site	probably null
IGL03155:Stxbp5	APN	10	9816290	missense	probably null	1.00
IGL03288:Stxbp5	APN	10	9866703	splice site	probably null
Fatty_fish	UTSW	10	9770551	missense	probably damaging	1.00
reindeer	UTSW	10	9838092	missense	probably damaging	1.00
H8562:Stxbp5	UTSW	10	9769443	missense	probably benign	0.36
PIT4544001:Stxbp5	UTSW	10	9817304	critical splice donor site	probably null
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0025:Stxbp5	UTSW	10	9762748	missense	probably damaging	1.00
R0219:Stxbp5	UTSW	10	9770528	missense	probably benign	0.36
R0226:Stxbp5	UTSW	10	9866698	splice site	probably benign
R0631:Stxbp5	UTSW	10	9784358	missense	probably benign
R0723:Stxbp5	UTSW	10	9768873	missense	probably damaging	1.00
R0833:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0836:Stxbp5	UTSW	10	9865099	missense	probably damaging	1.00
R0863:Stxbp5	UTSW	10	9809040	missense	possibly damaging	0.86
R1225:Stxbp5	UTSW	10	9812391	missense	possibly damaging	0.94
R1271:Stxbp5	UTSW	10	9816269	missense	probably damaging	1.00
R1536:Stxbp5	UTSW	10	9838092	missense	probably damaging	1.00
R1852:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1884:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1902:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1917:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R1918:Stxbp5	UTSW	10	9812298	missense	possibly damaging	0.94
R2174:Stxbp5	UTSW	10	9835846	missense	possibly damaging	0.69
R3773:Stxbp5	UTSW	10	9768927	missense	probably damaging	1.00
R3901:Stxbp5	UTSW	10	9769419	missense	probably damaging	1.00
R3981:Stxbp5	UTSW	10	9789316	intron	probably benign
R4764:Stxbp5	UTSW	10	9770623	missense	probably damaging	1.00
R4841:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4842:Stxbp5	UTSW	10	9762891	missense	probably benign	0.06
R4884:Stxbp5	UTSW	10	9812341	nonsense	probably null
R4887:Stxbp5	UTSW	10	9809100	missense	probably benign
R4930:Stxbp5	UTSW	10	9760866	utr 3 prime	probably benign
R5065:Stxbp5	UTSW	10	9770551	missense	probably damaging	1.00
R5285:Stxbp5	UTSW	10	9798275	critical splice acceptor site	probably null
R5306:Stxbp5	UTSW	10	9799991	missense	probably damaging	1.00
R5455:Stxbp5	UTSW	10	9808508	missense	probably benign
R5531:Stxbp5	UTSW	10	9762924	nonsense	probably null
R5605:Stxbp5	UTSW	10	9769746	intron	probably benign
R5614:Stxbp5	UTSW	10	9760894	utr 3 prime	probably benign
R5805:Stxbp5	UTSW	10	9900586	missense	probably benign
R5990:Stxbp5	UTSW	10	9835933	missense	probably damaging	1.00
R6025:Stxbp5	UTSW	10	9800028	missense	probably benign	0.00
R6056:Stxbp5	UTSW	10	9770686	missense	probably benign	0.00
R6147:Stxbp5	UTSW	10	9808472	missense	possibly damaging	0.93
R6194:Stxbp5	UTSW	10	9817339	missense	probably damaging	0.99
R6284:Stxbp5	UTSW	10	9767179	missense	probably benign	0.32
R6284:Stxbp5	UTSW	10	9767187	missense	probably damaging	1.00
R6394:Stxbp5	UTSW	10	9899231	nonsense	probably null
R6427:Stxbp5	UTSW	10	9899254	missense	probably damaging	1.00
R6894:Stxbp5	UTSW	10	9784361	missense	probably benign	0.00
R7229:Stxbp5	UTSW	10	9798187	missense	probably damaging	1.00
R7337:Stxbp5	UTSW	10	9809130	missense	possibly damaging	0.93
R7686:Stxbp5	UTSW	10	9769410	missense	probably damaging	0.99
R7811:Stxbp5	UTSW	10	9808504	missense	probably benign
R7974:Stxbp5	UTSW	10	9770695	splice site	probably null
R8009:Stxbp5	UTSW	10	9816302	missense	probably damaging	1.00
R8287:Stxbp5	UTSW	10	9784385	missense	probably benign
R8353:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8360:Stxbp5	UTSW	10	9812259	critical splice donor site	probably null
R8453:Stxbp5	UTSW	10	9809048	missense	probably benign	0.30
R8487:Stxbp5	UTSW	10	9812289	missense	possibly damaging	0.80
R8548:Stxbp5	UTSW	10	9817306	missense	probably null	0.98
R8805:Stxbp5	UTSW	10	9838115	nonsense	probably null
X0020:Stxbp5	UTSW	10	9762890	missense	possibly damaging	0.47
Z1176:Stxbp5	UTSW	10	9900545	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AGGCTTTGTTTCAGTGGAATCC -3'
(R):5'- TGCAGATCTGTCCTGCTGTG -3'

Sequencing Primer
(F):5'- TTCAGTGGAATCCGAAAAACTTCCG -3'
(R):5'- AGATCTGTCCTGCTGTGTTCTCG -3'

Posted On

2015-09-24