Incidental Mutation 'R4572:Plppr3'
ID 342207
Institutional Source Beutler Lab
Gene Symbol Plppr3
Ensembl Gene ENSMUSG00000035835
Gene Name phospholipid phosphatase related 3
Synonyms BC005764, Lppr3
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 79860475-79874634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 79866063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 315 (Q315L)
Ref Sequence ENSEMBL: ENSMUSP00000130695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057343] [ENSMUST00000092325] [ENSMUST00000095457] [ENSMUST00000165601] [ENSMUST00000165704] [ENSMUST00000165724] [ENSMUST00000166023] [ENSMUST00000167250] [ENSMUST00000167707] [ENSMUST00000167897] [ENSMUST00000172282]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000057343
SMART Domains Protein: ENSMUSP00000059481
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092325
AA Change: Q315L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000089979
Gene: ENSMUSG00000035835
AA Change: Q315L

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
coiled coil region 430 460 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095457
SMART Domains Protein: ENSMUSP00000093109
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_6 36 86 1.9e-5 PFAM
Pfam:RRM_5 38 90 3.6e-12 PFAM
low complexity region 121 138 N/A INTRINSIC
RRM 144 213 4.75e-7 SMART
low complexity region 265 290 N/A INTRINSIC
RRM 296 365 1.84e-13 SMART
RRM 413 483 2.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165153
Predicted Effect probably benign
Transcript: ENSMUST00000165601
SMART Domains Protein: ENSMUSP00000128681
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 266 7.27e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165704
SMART Domains Protein: ENSMUSP00000127783
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 305 330 N/A INTRINSIC
RRM 336 405 1.84e-13 SMART
RRM 453 523 2.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165724
SMART Domains Protein: ENSMUSP00000130749
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
Pfam:RRM_5 2 40 5.3e-7 PFAM
low complexity region 114 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166023
SMART Domains Protein: ENSMUSP00000127171
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166593
Predicted Effect probably benign
Transcript: ENSMUST00000167250
AA Change: Q315L

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130695
Gene: ENSMUSG00000035835
AA Change: Q315L

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
acidPPc 132 276 1.38e-16 SMART
low complexity region 437 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167707
SMART Domains Protein: ENSMUSP00000132994
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Blast:acidPPc 125 159 8e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169580
Predicted Effect probably benign
Transcript: ENSMUST00000167897
SMART Domains Protein: ENSMUSP00000127972
Gene: ENSMUSG00000035835

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172282
SMART Domains Protein: ENSMUSP00000126192
Gene: ENSMUSG00000006498

DomainStartEndE-ValueType
low complexity region 32 38 N/A INTRINSIC
RRM 59 128 9.8e-9 SMART
low complexity region 161 178 N/A INTRINSIC
RRM 184 253 4.75e-7 SMART
low complexity region 331 356 N/A INTRINSIC
RRM 362 431 1.84e-13 SMART
RRM 479 549 2.6e-13 SMART
Meta Mutation Damage Score 0.0720 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteins in the lipid phosphate phosphatase (LPP) family, including PRG2, are integral membrane proteins that modulate bioactive lipid phosphates including phosphatidate, lysophosphatidate, and sphingosine-1-phosphate in the context of cell migration, neurite retraction, and mitogenesis (Brauer et al., 2003 [PubMed 12730698]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Plppr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Plppr3 APN 10 79866669 missense probably damaging 1.00
IGL01108:Plppr3 APN 10 79867521 missense probably damaging 1.00
IGL01116:Plppr3 APN 10 79866923 missense probably damaging 1.00
IGL01362:Plppr3 APN 10 79865961 missense probably damaging 1.00
IGL03065:Plppr3 APN 10 79866046 missense probably benign 0.06
R0972:Plppr3 UTSW 10 79865086 missense probably damaging 0.99
R1508:Plppr3 UTSW 10 79867540 missense probably damaging 1.00
R1844:Plppr3 UTSW 10 79866410 critical splice donor site probably null
R1907:Plppr3 UTSW 10 79874069 missense probably damaging 1.00
R1982:Plppr3 UTSW 10 79866425 missense probably damaging 1.00
R1984:Plppr3 UTSW 10 79867460 nonsense probably null
R1985:Plppr3 UTSW 10 79867460 nonsense probably null
R2116:Plppr3 UTSW 10 79865738 missense probably benign 0.01
R2355:Plppr3 UTSW 10 79865360 missense possibly damaging 0.81
R4092:Plppr3 UTSW 10 79867480 missense probably damaging 1.00
R4685:Plppr3 UTSW 10 79867525 missense probably damaging 1.00
R4824:Plppr3 UTSW 10 79865673 missense possibly damaging 0.81
R5102:Plppr3 UTSW 10 79865386 missense possibly damaging 0.84
R5212:Plppr3 UTSW 10 79862445 missense probably benign 0.00
R5584:Plppr3 UTSW 10 79866452 missense probably damaging 1.00
R5684:Plppr3 UTSW 10 79865317 missense possibly damaging 0.81
R5778:Plppr3 UTSW 10 79866503 missense possibly damaging 0.78
R5954:Plppr3 UTSW 10 79866126 missense probably benign 0.05
R6306:Plppr3 UTSW 10 79861732 nonsense probably null
R6357:Plppr3 UTSW 10 79865406 missense probably benign 0.06
R7134:Plppr3 UTSW 10 79865703 missense probably damaging 0.96
R7657:Plppr3 UTSW 10 79866438 missense probably benign 0.21
R8051:Plppr3 UTSW 10 79867004 missense probably damaging 1.00
R8463:Plppr3 UTSW 10 79867563 missense probably damaging 1.00
X0067:Plppr3 UTSW 10 79865284 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACGTGGATAGTCATGTGGCG -3'
(R):5'- CATAGAATGCTGGTGCCTCC -3'

Sequencing Primer
(F):5'- ATAGTCATGTGGCGCCGTG -3'
(R):5'- AATGCTGGTGCCTCCCTGTG -3'
Posted On 2015-09-24