Incidental Mutation 'R4572:Cnot2'
ID 342208
Institutional Source Beutler Lab
Gene Symbol Cnot2
Ensembl Gene ENSMUSG00000020166
Gene Name CCR4-NOT transcription complex, subunit 2
Synonyms 2810470K03Rik, 2600016M12Rik
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock # R4572 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 116485161-116581511 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116494846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 423 (T423A)
Ref Sequence ENSEMBL: ENSMUSP00000132152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105265] [ENSMUST00000105267] [ENSMUST00000164088] [ENSMUST00000167706] [ENSMUST00000168036] [ENSMUST00000169576] [ENSMUST00000169921]
AlphaFold Q8C5L3
Predicted Effect probably benign
Transcript: ENSMUST00000105265
AA Change: T338A

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100900
Gene: ENSMUSG00000020166
AA Change: T338A

DomainStartEndE-ValueType
low complexity region 68 87 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
Pfam:NOT2_3_5 310 437 1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105267
AA Change: T423A

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100902
Gene: ENSMUSG00000020166
AA Change: T423A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 396 521 8.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164088
AA Change: T382A

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127830
Gene: ENSMUSG00000020166
AA Change: T382A

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166166
Predicted Effect probably benign
Transcript: ENSMUST00000167706
AA Change: T373A

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000128837
Gene: ENSMUSG00000020166
AA Change: T373A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:NOT2_3_5 345 472 2.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168036
AA Change: T382A

PolyPhen 2 Score 0.219 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132315
Gene: ENSMUSG00000020166
AA Change: T382A

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
Pfam:NOT2_3_5 354 481 2.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169576
Predicted Effect probably benign
Transcript: ENSMUST00000169921
AA Change: T423A

PolyPhen 2 Score 0.374 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132152
Gene: ENSMUSG00000020166
AA Change: T423A

DomainStartEndE-ValueType
low complexity region 153 172 N/A INTRINSIC
low complexity region 298 312 N/A INTRINSIC
Pfam:NOT2_3_5 395 522 1.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219544
Meta Mutation Damage Score 0.1600 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the multi-component CCR4-NOT complex. The CCR4-NOT complex regulates mRNA synthesis and degradation and is also thought to be involved in mRNA splicing, transport and localization. The encoded protein interacts with histone deacetylases and functions as a repressor of polymerase II transcription. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Cnot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Cnot2 APN 10 116507071 missense probably benign 0.02
IGL02433:Cnot2 APN 10 116492336 missense possibly damaging 0.82
IGL03066:Cnot2 APN 10 116499357 missense probably benign 0.15
IGL03383:Cnot2 APN 10 116494817 splice site probably benign
R0145:Cnot2 UTSW 10 116517368 missense possibly damaging 0.90
R0497:Cnot2 UTSW 10 116498355 missense probably damaging 1.00
R0615:Cnot2 UTSW 10 116498236 missense possibly damaging 0.89
R1935:Cnot2 UTSW 10 116498415 missense possibly damaging 0.62
R1985:Cnot2 UTSW 10 116527876 missense probably damaging 0.99
R2148:Cnot2 UTSW 10 116506280 missense probably benign 0.01
R4063:Cnot2 UTSW 10 116537396 missense possibly damaging 0.46
R4179:Cnot2 UTSW 10 116498143 missense possibly damaging 0.81
R4196:Cnot2 UTSW 10 116501304 missense possibly damaging 0.62
R4523:Cnot2 UTSW 10 116581474 unclassified probably benign
R4610:Cnot2 UTSW 10 116499418 missense probably damaging 1.00
R5219:Cnot2 UTSW 10 116506310 splice site probably null
R5847:Cnot2 UTSW 10 116527946 missense probably damaging 0.98
R6444:Cnot2 UTSW 10 116499355 missense probably benign 0.02
R6733:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6734:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6735:Cnot2 UTSW 10 116498153 missense possibly damaging 0.81
R6944:Cnot2 UTSW 10 116537223 intron probably benign
R7139:Cnot2 UTSW 10 116495019 missense probably benign 0.00
R7248:Cnot2 UTSW 10 116498373 missense probably benign 0.05
R7423:Cnot2 UTSW 10 116492398 missense probably damaging 1.00
R7526:Cnot2 UTSW 10 116507080 missense probably benign 0.12
R7851:Cnot2 UTSW 10 116537432 missense possibly damaging 0.66
R8245:Cnot2 UTSW 10 116510389 missense probably benign 0.07
R8350:Cnot2 UTSW 10 116486276 missense probably damaging 1.00
R8463:Cnot2 UTSW 10 116517331 missense probably benign 0.11
R9045:Cnot2 UTSW 10 116486255 missense probably benign 0.05
R9175:Cnot2 UTSW 10 116498146 missense possibly damaging 0.94
R9229:Cnot2 UTSW 10 116549055 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGGAAGAGAATCACCAAATTTTCC -3'
(R):5'- AAGCGCTCTTGGGTTACTTTTC -3'

Sequencing Primer
(F):5'- GTATTTCCATTCACTATGGTTAC -3'
(R):5'- GGGTTACTTTTCTGCTATAAAGTTGC -3'
Posted On 2015-09-24