Mutagenetix > Incidental Mutation

Incidental Mutation 'R4572:Zfp735'

342212

Institutional Source

Beutler Lab

Gene Symbol

Zfp735

Ensembl Gene

ENSMUSG00000060630

Gene Name

zinc finger protein 735

Synonyms

1700012C15Rik

MMRRC Submission

041796-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73688778-73713798 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 73689785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 37 (M37V)

Ref Sequence

ENSEMBL: ENSMUSP00000079269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080407]

AlphaFold

B1ARH2

Predicted Effect

probably benign
Transcript: ENSMUST00000080407
AA Change: M37V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: M37V

Domain	Start	End	E-Value	Type
KRAB	8	68	2.2e-34	SMART
ZnF_C2H2	483	505	4.38e1	SMART
ZnF_C2H2	511	533	2.67e-1	SMART
ZnF_C2H2	539	561	1.81e1	SMART
ZnF_C2H2	567	589	1.5e-4	SMART
ZnF_C2H2	595	617	4.87e-4	SMART
ZnF_C2H2	623	645	4.24e-4	SMART
ZnF_C2H2	651	673	2.27e-4	SMART
ZnF_C2H2	679	701	7.49e-5	SMART
ZnF_C2H2	707	729	4.87e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149560

Meta Mutation Damage Score

0.2392

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Zfp735

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Zfp735	APN	11	73711366	missense	possibly damaging	0.86
IGL00798:Zfp735	APN	11	73711560	missense	possibly damaging	0.72
IGL01642:Zfp735	APN	11	73710479	missense	possibly damaging	0.73
IGL01684:Zfp735	APN	11	73690365	missense	possibly damaging	0.86
IGL02096:Zfp735	APN	11	73711428	missense	probably benign	0.01
IGL02238:Zfp735	APN	11	73710493	missense	probably benign	0.00
IGL02505:Zfp735	APN	11	73689800	missense	probably benign	0.03
IGL02740:Zfp735	APN	11	73710586	missense	possibly damaging	0.53
IGL02957:Zfp735	APN	11	73710929	missense	probably benign	0.00
bananaquit	UTSW	11	73710586	nonsense	probably null
bescher	UTSW	11	73712153	missense	possibly damaging	0.93
Galvanic	UTSW	11	73711678	nonsense	probably null
grassquit	UTSW	11	73712203	missense	possibly damaging	0.66
R0114:Zfp735	UTSW	11	73710662	missense	probably benign	0.33
R0217:Zfp735	UTSW	11	73711286	missense	possibly damaging	0.73
R0943:Zfp735	UTSW	11	73712083	missense	probably benign	0.04
R1421:Zfp735	UTSW	11	73710697	missense	probably benign
R1460:Zfp735	UTSW	11	73712333	missense	possibly damaging	0.73
R1493:Zfp735	UTSW	11	73710479	missense	possibly damaging	0.73
R1517:Zfp735	UTSW	11	73710644	missense	probably benign
R1676:Zfp735	UTSW	11	73711475	missense	possibly damaging	0.53
R1709:Zfp735	UTSW	11	73711763	missense	probably benign	0.01
R1871:Zfp735	UTSW	11	73710586	nonsense	probably null
R1931:Zfp735	UTSW	11	73711851	missense	possibly damaging	0.69
R2219:Zfp735	UTSW	11	73711025	missense	possibly damaging	0.53
R2227:Zfp735	UTSW	11	73711396	missense	possibly damaging	0.53
R2227:Zfp735	UTSW	11	73711397	nonsense	probably null
R3552:Zfp735	UTSW	11	73711241	nonsense	probably null
R3856:Zfp735	UTSW	11	73711456	missense	probably benign	0.01
R3925:Zfp735	UTSW	11	73711124	missense	probably benign	0.33
R4585:Zfp735	UTSW	11	73689724	missense	possibly damaging	0.51
R4586:Zfp735	UTSW	11	73689724	missense	possibly damaging	0.51
R4619:Zfp735	UTSW	11	73711205	missense	probably damaging	0.98
R4687:Zfp735	UTSW	11	73711855	missense	probably damaging	0.98
R4687:Zfp735	UTSW	11	73711856	missense	probably damaging	0.98
R5435:Zfp735	UTSW	11	73712113	missense	possibly damaging	0.72
R5489:Zfp735	UTSW	11	73710593	nonsense	probably null
R5516:Zfp735	UTSW	11	73710814	missense	probably benign
R5654:Zfp735	UTSW	11	73712138	missense	possibly damaging	0.71
R5990:Zfp735	UTSW	11	73690348	missense	possibly damaging	0.70
R6332:Zfp735	UTSW	11	73711678	nonsense	probably null
R6427:Zfp735	UTSW	11	73690314	missense	possibly damaging	0.73
R6460:Zfp735	UTSW	11	73711652	missense	probably benign	0.33
R6820:Zfp735	UTSW	11	73688957	start codon destroyed	probably null	0.01
R6831:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6833:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6834:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6897:Zfp735	UTSW	11	73711054	missense	probably benign	0.08
R6941:Zfp735	UTSW	11	73690333	missense	probably benign	0.33
R7335:Zfp735	UTSW	11	73711553	missense	possibly damaging	0.47
R7366:Zfp735	UTSW	11	73712153	missense	possibly damaging	0.93
R7474:Zfp735	UTSW	11	73711176	missense	possibly damaging	0.72
R7487:Zfp735	UTSW	11	73690328	missense	possibly damaging	0.53
R7583:Zfp735	UTSW	11	73711107	missense	possibly damaging	0.86
R7866:Zfp735	UTSW	11	73710803	missense	probably benign	0.00
R8005:Zfp735	UTSW	11	73712314	nonsense	probably null
R8500:Zfp735	UTSW	11	73710985	missense	possibly damaging	0.53
R8551:Zfp735	UTSW	11	73712296	missense	probably benign	0.06
R8754:Zfp735	UTSW	11	73712174	missense	possibly damaging	0.85
R8769:Zfp735	UTSW	11	73690301	missense	possibly damaging	0.53
R8794:Zfp735	UTSW	11	73712203	missense	possibly damaging	0.66
R8835:Zfp735	UTSW	11	73710866	missense	possibly damaging	0.53
R8869:Zfp735	UTSW	11	73711684	missense	possibly damaging	0.53
R8969:Zfp735	UTSW	11	73711873	missense	possibly damaging	0.83
R9072:Zfp735	UTSW	11	73712234	missense	probably benign	0.21
R9073:Zfp735	UTSW	11	73712234	missense	probably benign	0.21
R9193:Zfp735	UTSW	11	73689774	missense	possibly damaging	0.71
R9355:Zfp735	UTSW	11	73711536	missense	probably benign	0.01
R9414:Zfp735	UTSW	11	73711197	nonsense	probably null
R9456:Zfp735	UTSW	11	73711577	missense	possibly damaging	0.53
R9573:Zfp735	UTSW	11	73712110	missense	possibly damaging	0.67
R9647:Zfp735	UTSW	11	73689774	missense	probably damaging	0.98
R9710:Zfp735	UTSW	11	73710980	missense	possibly damaging	0.86
Z1176:Zfp735	UTSW	11	73710815	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGGTCACAGCATTCTTTCTCTCAG -3'
(R):5'- GGAATGTGCCGTGTAGATAACATG -3'

Sequencing Primer
(F):5'- GACACAAGGGATTAGTGTGA -3'
(R):5'- CCACATTAGAAATAAGACAACTGTGG -3'

Posted On

2015-09-24