Incidental Mutation 'R4572:Srcin1'
ID 342214
Institutional Source Beutler Lab
Gene Symbol Srcin1
Ensembl Gene ENSMUSG00000038453
Gene Name SRC kinase signaling inhibitor 1
Synonyms p140Cap, P140
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4572 (G1)
Quality Score 93
Status Validated
Chromosome 11
Chromosomal Location 97509340-97576186 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 97534934 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 432 (D432E)
Ref Sequence ENSEMBL: ENSMUSP00000103222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107590] [ENSMUST00000107593] [ENSMUST00000107596] [ENSMUST00000126287]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107590
AA Change: D433E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103216
Gene: ENSMUSG00000038453
AA Change: D433E

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107593
AA Change: D433E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103219
Gene: ENSMUSG00000038453
AA Change: D433E

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107596
AA Change: D432E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103222
Gene: ENSMUSG00000038453
AA Change: D432E

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:THAP 79 108 8e-10 BLAST
low complexity region 118 128 N/A INTRINSIC
Pfam:AIP3 218 330 2e-11 PFAM
low complexity region 331 365 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 515 537 N/A INTRINSIC
low complexity region 557 574 N/A INTRINSIC
low complexity region 654 678 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
coiled coil region 750 783 N/A INTRINSIC
low complexity region 1033 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126287
AA Change: D458E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116444
Gene: ENSMUSG00000038453
AA Change: D458E

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 7e-10 BLAST
low complexity region 152 162 N/A INTRINSIC
Pfam:AIP3 244 339 9.7e-10 PFAM
low complexity region 357 391 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in object recognition memory and motor learning, dendritic spine disorganization, impaired synaptic plasticity, and reduced long term potentiation and long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Srcin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Srcin1 APN 11 97533098 missense possibly damaging 0.81
IGL03347:Srcin1 APN 11 97525344 missense probably damaging 1.00
R1619:Srcin1 UTSW 11 97525481 missense probably damaging 1.00
R1678:Srcin1 UTSW 11 97518644 missense probably damaging 0.99
R1733:Srcin1 UTSW 11 97533501 missense probably benign
R2023:Srcin1 UTSW 11 97526046 missense probably benign
R2238:Srcin1 UTSW 11 97534819 missense probably benign 0.00
R3983:Srcin1 UTSW 11 97525553 missense probably damaging 1.00
R4628:Srcin1 UTSW 11 97548926 missense probably benign 0.12
R4946:Srcin1 UTSW 11 97551942 missense probably damaging 1.00
R5175:Srcin1 UTSW 11 97573877 missense probably damaging 0.99
R5424:Srcin1 UTSW 11 97537059 nonsense probably null
R5705:Srcin1 UTSW 11 97548951 missense probably benign 0.42
R5918:Srcin1 UTSW 11 97533497 splice site probably null
R6563:Srcin1 UTSW 11 97534774 missense possibly damaging 0.74
R6613:Srcin1 UTSW 11 97533827 missense possibly damaging 0.94
R6756:Srcin1 UTSW 11 97535010 missense probably damaging 1.00
R6805:Srcin1 UTSW 11 97551980 critical splice acceptor site probably null
R7060:Srcin1 UTSW 11 97573885 missense probably damaging 0.99
R7271:Srcin1 UTSW 11 97551889 missense probably damaging 0.99
R7304:Srcin1 UTSW 11 97551693 missense probably benign 0.01
R7469:Srcin1 UTSW 11 97534609 missense probably damaging 0.98
R7567:Srcin1 UTSW 11 97534725 missense probably damaging 1.00
R7846:Srcin1 UTSW 11 97526100 nonsense probably null
R7994:Srcin1 UTSW 11 97531916 missense probably damaging 1.00
R8203:Srcin1 UTSW 11 97566713 missense probably damaging 1.00
R8377:Srcin1 UTSW 11 97551978 missense probably damaging 0.99
R8488:Srcin1 UTSW 11 97525860 splice site probably null
R8559:Srcin1 UTSW 11 97537149 missense probably damaging 1.00
R8690:Srcin1 UTSW 11 97523542 missense probably damaging 1.00
R8794:Srcin1 UTSW 11 97548977 missense probably benign 0.00
R8982:Srcin1 UTSW 11 97535798 missense probably damaging 1.00
R9061:Srcin1 UTSW 11 97536380 missense probably damaging 1.00
R9253:Srcin1 UTSW 11 97525551 missense probably damaging 1.00
X0024:Srcin1 UTSW 11 97536468 missense probably damaging 1.00
Z1176:Srcin1 UTSW 11 97518727 missense possibly damaging 0.88
Z1177:Srcin1 UTSW 11 97526861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATCTTTGCGGAAGGACTGG -3'
(R):5'- CATCGCACCTAGCATCTAGC -3'

Sequencing Primer
(F):5'- AAGCCATAGCCGTCTCCGTAG -3'
(R):5'- ACGCCTCTCCTATGCTGGG -3'
Posted On 2015-09-24