Incidental Mutation 'R4572:Wnt9b'
ID 342215
Institutional Source Beutler Lab
Gene Symbol Wnt9b
Ensembl Gene ENSMUSG00000018486
Gene Name wingless-type MMTV integration site family, member 9B
Synonyms Wnt15, Wnt14b, clf, clf1
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4572 (G1)
Quality Score 180
Status Validated
Chromosome 11
Chromosomal Location 103727364-103749821 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103732155 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 141 (R141C)
Ref Sequence ENSEMBL: ENSMUSP00000018630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018630]
AlphaFold O35468
Predicted Effect probably damaging
Transcript: ENSMUST00000018630
AA Change: R141C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018630
Gene: ENSMUSG00000018486
AA Change: R141C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 44 52 N/A INTRINSIC
WNT1 58 358 5.38e-98 SMART
Meta Mutation Damage Score 0.3010 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. Study of its expression in the teratocarcinoma cell line NT2 suggests that it may be implicated in the early process of neuronal differentiation of NT2 cells induced by retinoic acid. This gene is clustered with WNT3, another family member, in the chromosome 17q21 region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display neonatal lethality, disrupted ureteric bud branching, impaired Mullerian duct formation, and incompletely penetrant cleft lip and palate. In mice with alleles that decrease expression kidneys are smaller with fewer mature nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Ptger4 A C 15: 5,243,133 S2A probably benign Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Wnt9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Wnt9b APN 11 103732010 missense probably damaging 1.00
IGL01517:Wnt9b APN 11 103731081 missense probably benign 0.13
IGL02348:Wnt9b APN 11 103732082 missense probably damaging 1.00
market UTSW 11 103731228 splice site probably null
R1711:Wnt9b UTSW 11 103732128 missense probably damaging 1.00
R1956:Wnt9b UTSW 11 103730812 missense probably damaging 1.00
R4044:Wnt9b UTSW 11 103731998 missense probably damaging 1.00
R4619:Wnt9b UTSW 11 103731123 missense probably benign 0.13
R5239:Wnt9b UTSW 11 103731228 splice site probably null
R5260:Wnt9b UTSW 11 103732049 missense possibly damaging 0.87
R6962:Wnt9b UTSW 11 103733689 missense probably null 0.76
R7428:Wnt9b UTSW 11 103730817 missense probably benign 0.05
R8186:Wnt9b UTSW 11 103730775 missense probably damaging 0.99
R8693:Wnt9b UTSW 11 103733661 missense probably damaging 0.98
Z1177:Wnt9b UTSW 11 103732037 missense probably damaging 1.00
Z1177:Wnt9b UTSW 11 103733650 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGGTATTCGCTCACCTTGATGC -3'
(R):5'- ATAGCCTTTAGGAAGCCGGG -3'

Sequencing Primer
(F):5'- ACCTTGATGCCCACGTG -3'
(R):5'- TTAGGCTCACACTGCGTCAAC -3'
Posted On 2015-09-24