Mutagenetix > Incidental Mutations

Incidental Mutation 'R4572:Abca6'

342216

Institutional Source

Beutler Lab

Gene Symbol

Abca6

Ensembl Gene

ENSMUSG00000044749

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 6

Synonyms

6330565N06Rik

MMRRC Submission

041796-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110176820-110251776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110216548 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 747 (I747N)

Ref Sequence

ENSEMBL: ENSMUSP00000035458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044003]

Predicted Effect

probably benign
Transcript: ENSMUST00000044003
AA Change: I747N

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: I747N

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	416	1.4e-42	PFAM
low complexity region	484	495	N/A	INTRINSIC
AAA	506	691	1.13e-6	SMART
transmembrane domain	854	876	N/A	INTRINSIC
transmembrane domain	971	990	N/A	INTRINSIC
transmembrane domain	1005	1027	N/A	INTRINSIC
Blast:AAA	1041	1176	4e-21	BLAST
transmembrane domain	1191	1213	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
AAA	1312	1505	2.43e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Abca6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca6	APN	11	110184709	missense	probably damaging	1.00
IGL00569:Abca6	APN	11	110187049	missense	possibly damaging	0.88
IGL00737:Abca6	APN	11	110196997	splice site	probably benign
IGL01024:Abca6	APN	11	110197142	missense	probably benign
IGL01087:Abca6	APN	11	110191650	missense	probably benign	0.00
IGL01511:Abca6	APN	11	110244310	missense	probably benign	0.00
IGL01516:Abca6	APN	11	110218217	missense	possibly damaging	0.70
IGL01621:Abca6	APN	11	110184708	missense	probably damaging	1.00
IGL01749:Abca6	APN	11	110244224	missense	probably damaging	1.00
IGL01934:Abca6	APN	11	110188655	missense	probably benign	0.00
IGL02010:Abca6	APN	11	110219616	missense	probably benign	0.12
IGL02121:Abca6	APN	11	110182924	missense	probably benign	0.38
IGL02423:Abca6	APN	11	110219006	splice site	probably benign
IGL02428:Abca6	APN	11	110178792	missense	possibly damaging	0.81
IGL02491:Abca6	APN	11	110176968	utr 3 prime	probably benign
IGL02541:Abca6	APN	11	110212267	missense	probably damaging	1.00
IGL02792:Abca6	APN	11	110188681	missense	probably damaging	0.99
IGL02836:Abca6	APN	11	110248548	missense	probably damaging	1.00
IGL02965:Abca6	APN	11	110180613	missense	probably benign
IGL03094:Abca6	APN	11	110184112	missense	probably benign	0.03
IGL03109:Abca6	APN	11	110180347	missense	probably damaging	0.96
R0068:Abca6	UTSW	11	110182882	missense	probably damaging	1.00
R0142:Abca6	UTSW	11	110188641	missense	probably damaging	1.00
R0165:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R0254:Abca6	UTSW	11	110236789	missense	probably benign	0.16
R0598:Abca6	UTSW	11	110197154	missense	probably damaging	1.00
R0992:Abca6	UTSW	11	110211684	missense	probably damaging	1.00
R1386:Abca6	UTSW	11	110244255	missense	probably benign	0.02
R1642:Abca6	UTSW	11	110218281	missense	possibly damaging	0.73
R1673:Abca6	UTSW	11	110212339	missense	probably benign	0.01
R1792:Abca6	UTSW	11	110184044	missense	probably benign	0.00
R1813:Abca6	UTSW	11	110233845	splice site	probably benign
R1817:Abca6	UTSW	11	110219318	missense	probably benign	0.00
R1842:Abca6	UTSW	11	110197039	missense	probably benign	0.00
R1898:Abca6	UTSW	11	110208799	missense	probably damaging	0.99
R1914:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1915:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1934:Abca6	UTSW	11	110210083	critical splice donor site	probably null
R1964:Abca6	UTSW	11	110184676	missense	probably damaging	0.98
R1967:Abca6	UTSW	11	110187148	missense	probably benign	0.09
R2127:Abca6	UTSW	11	110219649	missense	probably benign	0.00
R2128:Abca6	UTSW	11	110219649	missense	probably benign	0.00
R2164:Abca6	UTSW	11	110210193	frame shift	probably null
R2895:Abca6	UTSW	11	110202426	missense	probably benign	0.00
R3110:Abca6	UTSW	11	110178829	nonsense	probably null
R3111:Abca6	UTSW	11	110178829	nonsense	probably null
R3112:Abca6	UTSW	11	110178829	nonsense	probably null
R4094:Abca6	UTSW	11	110180366	missense	probably damaging	1.00
R4432:Abca6	UTSW	11	110241588	missense	probably benign	0.11
R4474:Abca6	UTSW	11	110233772	missense	possibly damaging	0.46
R4629:Abca6	UTSW	11	110230549	critical splice acceptor site	probably null
R4793:Abca6	UTSW	11	110191718	missense	probably benign
R4852:Abca6	UTSW	11	110244203	missense	probably benign	0.09
R4867:Abca6	UTSW	11	110202379	missense	probably benign	0.01
R4879:Abca6	UTSW	11	110219700	missense	probably damaging	0.98
R4918:Abca6	UTSW	11	110180551	missense	probably damaging	1.00
R5060:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R5062:Abca6	UTSW	11	110177066	missense	probably benign	0.12
R5083:Abca6	UTSW	11	110218967	missense	probably damaging	1.00
R5173:Abca6	UTSW	11	110191720	missense	probably benign
R5393:Abca6	UTSW	11	110244295	missense	probably benign	0.00
R5484:Abca6	UTSW	11	110184073	missense	probably damaging	1.00
R5498:Abca6	UTSW	11	110208844	missense	possibly damaging	0.95
R5503:Abca6	UTSW	11	110218257	missense	probably damaging	1.00
R5645:Abca6	UTSW	11	110250408	missense	probably damaging	0.99
R5680:Abca6	UTSW	11	110236645	missense	possibly damaging	0.88
R5761:Abca6	UTSW	11	110210101	missense	probably damaging	1.00
R5779:Abca6	UTSW	11	110184670	missense	probably benign	0.37
R5818:Abca6	UTSW	11	110219643	missense	probably damaging	1.00
R6282:Abca6	UTSW	11	110208824	missense	probably damaging	0.98
R6455:Abca6	UTSW	11	110241581	missense	probably damaging	1.00
R6826:Abca6	UTSW	11	110216605	missense	probably benign	0.15
R6857:Abca6	UTSW	11	110219688	missense	possibly damaging	0.63
R6914:Abca6	UTSW	11	110190238	missense	probably benign
R6931:Abca6	UTSW	11	110244328	missense	probably benign	0.27
R7222:Abca6	UTSW	11	110191693	missense	probably benign	0.29
R7242:Abca6	UTSW	11	110241653	missense	possibly damaging	0.47
R7297:Abca6	UTSW	11	110183026	critical splice donor site	probably null
R7387:Abca6	UTSW	11	110202420	missense	probably benign
R7420:Abca6	UTSW	11	110250477	missense	probably benign	0.24
R7494:Abca6	UTSW	11	110208745	missense	possibly damaging	0.93
R7603:Abca6	UTSW	11	110180258	missense	possibly damaging	0.69
R7637:Abca6	UTSW	11	110218952	missense	probably benign	0.00
R7674:Abca6	UTSW	11	110219297	missense	probably damaging	1.00
R7753:Abca6	UTSW	11	110184107	missense	probably damaging	1.00
R7800:Abca6	UTSW	11	110187872	missense	probably benign	0.00
X0024:Abca6	UTSW	11	110244255	missense	probably benign	0.02
X0064:Abca6	UTSW	11	110197142	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCCTGCTATTGATTGCACTGAC -3'
(R):5'- GAAGATTTTCAAGCTGCTGGATTAC -3'

Sequencing Primer
(F):5'- TGATTGCACTGACTAAGTAACACC -3'
(R):5'- ACCCATTTTGCTTGTTTCATAAAGC -3'

Posted On

2015-09-24