Mutagenetix > Incidental Mutation

Incidental Mutation 'R4572:Rgs14'

342220

Institutional Source

Beutler Lab

Gene Symbol

Rgs14

Ensembl Gene

ENSMUSG00000052087

Gene Name

regulator of G-protein signaling 14

Synonyms

Rap1/rap2 interacting protein

MMRRC Submission

041796-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.114) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

55369732-55384687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 55380062 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 266 (N266I)

Ref Sequence

ENSEMBL: ENSMUSP00000068731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063771] [ENSMUST00000149858]

AlphaFold

P97492

PDB Structure

Solution structure of the Ras-binding domain of mouse RGS14 [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000063771
AA Change: N266I

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000068731
Gene: ENSMUSG00000052087
AA Change: N266I

Domain	Start	End	E-Value	Type
RGS	67	184	3.42e-44	SMART
low complexity region	209	222	N/A	INTRINSIC
low complexity region	289	299	N/A	INTRINSIC
RBD	303	374	2e-26	SMART
RBD	376	446	4.53e-16	SMART
low complexity region	474	491	N/A	INTRINSIC
GoLoco	500	522	1.74e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135851

Predicted Effect

probably benign
Transcript: ENSMUST00000149858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224185

Meta Mutation Damage Score

0.1540

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling family. This protein contains one RGS domain, two Raf-like Ras-binding domains (RBDs), and one GoLoco domain. The protein attenuates the signaling activity of G-proteins by binding, through its GoLoco domain, to specific types of activated, GTP-bound G alpha subunits. Acting as a GTPase activating protein (GAP), the protein increases the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in failure to complete the first zygotic cell division. Homozygous mutation of this gene with a second allele results in no obvious phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kalrn	A	T	16: 34,392,042	F27L	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Rgs14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01820:Rgs14	APN	13	55383525	missense	probably benign	0.04
IGL02691:Rgs14	APN	13	55379023	splice site	probably null
R1655:Rgs14	UTSW	13	55383534	missense	probably benign	0.00
R1716:Rgs14	UTSW	13	55378883	missense	probably damaging	0.99
R1839:Rgs14	UTSW	13	55382838	unclassified	probably benign
R2014:Rgs14	UTSW	13	55383700	nonsense	probably null
R3851:Rgs14	UTSW	13	55379614	missense	possibly damaging	0.77
R4008:Rgs14	UTSW	13	55369913	missense	probably damaging	0.99
R4299:Rgs14	UTSW	13	55383753	missense	probably damaging	1.00
R4801:Rgs14	UTSW	13	55380957	missense	probably damaging	1.00
R4802:Rgs14	UTSW	13	55380957	missense	probably damaging	1.00
R7136:Rgs14	UTSW	13	55379695	splice site	probably null
R7142:Rgs14	UTSW	13	55379604	missense	probably damaging	0.99
R7207:Rgs14	UTSW	13	55383234	missense	probably benign	0.00
R7701:Rgs14	UTSW	13	55379325	missense	probably damaging	1.00
R8021:Rgs14	UTSW	13	55383756	missense	probably damaging	0.97
R8405:Rgs14	UTSW	13	55383149	missense	probably damaging	1.00
R8985:Rgs14	UTSW	13	55383421	unclassified	probably benign
R9120:Rgs14	UTSW	13	55380979	missense	probably damaging	1.00
R9706:Rgs14	UTSW	13	55384121	missense	probably benign	0.01
R9731:Rgs14	UTSW	13	55380971	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGGGACCCACACACTTTAAGTC -3'
(R):5'- TCCATGGTATGTACAGAGACCAC -3'

Sequencing Primer
(F):5'- ACACACTTTAAGTCCTCGAAGG -3'
(R):5'- GAGACCACTCTATCTGGCACG -3'

Posted On

2015-09-24