Incidental Mutation 'R4572:Ptger4'
ID342222
Institutional Source Beutler Lab
Gene Symbol Ptger4
Ensembl Gene ENSMUSG00000039942
Gene Nameprostaglandin E receptor 4 (subtype EP4)
SynonymsEP4, Ptgerep4
MMRRC Submission 041796-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.272) question?
Stock #R4572 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location5206661-5244187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 5243133 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 2 (S2A)
Ref Sequence ENSEMBL: ENSMUSP00000112858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047379] [ENSMUST00000120563]
Predicted Effect probably benign
Transcript: ENSMUST00000047379
AA Change: S27A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000048736
Gene: ENSMUSG00000039942
AA Change: S27A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 258 1.3e-7 PFAM
Pfam:7tm_1 59 357 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120563
AA Change: S2A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112858
Gene: ENSMUSG00000039942
AA Change: S2A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 25 233 1.9e-7 PFAM
Pfam:7tm_1 34 332 8.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133966
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family. This protein is one of four receptors identified for prostaglandin E2 (PGE2). This receptor can activate T-cell factor signaling. It has been shown to mediate PGE2 induced expression of early growth response 1 (EGR1), regulate the level and stability of cyclooxygenase-2 mRNA, and lead to the phosphorylation of glycogen synthase kinase-3. Knockout studies in mice suggest that this receptor may be involved in the neonatal adaptation of circulatory system, osteoporosis, as well as initiation of skin immune responses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous targeted null mutants die shortly after birth due to failed closure of the ductus arteriosis. Survivors show decreased migration of Langerhans cells to lymph nodes, contact hypersensitivity and decreased incidence of induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,216,548 I747N probably benign Het
Adamtsl2 A G 2: 27,083,256 Y97C probably damaging Het
Alox12e A G 11: 70,321,181 probably benign Het
Alpk2 A T 18: 65,281,004 S2014T probably damaging Het
Ankrd36 A T 11: 5,689,340 probably null Het
Apobec1 T C 6: 122,581,397 D133G probably damaging Het
Arfgef1 A T 1: 10,213,141 I181N probably damaging Het
C130060K24Rik A T 6: 65,454,991 M293L probably benign Het
Cilp2 A G 8: 69,882,410 V646A probably damaging Het
Clasrp A G 7: 19,584,464 probably null Het
Cnot2 T C 10: 116,494,846 T423A probably benign Het
Crtap T C 9: 114,384,806 D227G probably benign Het
Cyp17a1 A G 19: 46,670,551 F217S probably damaging Het
Ddx60 A G 8: 61,987,421 M1036V probably damaging Het
Dnah11 A T 12: 118,010,125 I2818N probably benign Het
Dok6 T A 18: 89,473,947 I169F possibly damaging Het
Duox2 T A 2: 122,281,726 R1326S probably benign Het
Epha10 A G 4: 124,902,568 T357A unknown Het
Ephb2 A C 4: 136,655,940 F942C probably damaging Het
Fscn3 T A 6: 28,430,635 probably null Het
Gabrb2 A G 11: 42,593,917 N267S possibly damaging Het
Gabrr3 A T 16: 59,461,638 Y452F probably benign Het
Gen1 A G 12: 11,242,418 S457P probably damaging Het
Gm1993 C T X: 25,560,356 R77H probably damaging Het
Gm5592 G A 7: 41,216,159 probably benign Het
Hmbox1 A G 14: 64,903,233 probably null Het
Hus1 A T 11: 9,007,617 probably null Het
Ino80 G A 2: 119,402,358 R1160W probably damaging Het
Kalrn A T 16: 34,392,042 F27L probably damaging Het
Kri1 A T 9: 21,280,384 F187L probably damaging Het
Lekr1 A T 3: 65,783,915 noncoding transcript Het
Mapk15 T C 15: 75,998,750 probably benign Het
Mrgpre G A 7: 143,781,104 L221F probably damaging Het
Mrpl50 A T 4: 49,514,399 S91T possibly damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mup15 A G 4: 61,438,217 probably null Het
Ncapd3 A G 9: 27,094,615 D1469G probably damaging Het
Nlrp9b G A 7: 20,026,681 probably null Het
Npy6r A T 18: 44,275,917 Y135F probably benign Het
Olfr862 A C 9: 19,883,979 C109G probably benign Het
Phf14 G A 6: 12,006,824 R825Q probably damaging Het
Pigg A G 5: 108,332,885 M379V probably benign Het
Plppr3 T A 10: 79,866,063 Q315L probably benign Het
Plxnd1 C A 6: 115,955,756 C1921F probably damaging Het
Rab4a A T 8: 123,834,060 D196V probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rgs14 A T 13: 55,380,062 N266I probably damaging Het
Serpina1c A T 12: 103,898,708 probably benign Het
Sesn3 G A 9: 14,321,220 R263H probably benign Het
Slfn1 A T 11: 83,121,463 D135V probably benign Het
Spata17 T C 1: 187,193,996 K46E possibly damaging Het
Srcin1 A C 11: 97,534,934 D432E probably damaging Het
Stxbp5 T C 10: 9,838,144 E217G probably damaging Het
Terf2ip A G 8: 112,012,017 D179G probably damaging Het
Tll1 A G 8: 64,056,309 F556L possibly damaging Het
Tmed4 CTCTTTCT CTCT 11: 6,274,461 probably null Het
Trappc9 G T 15: 72,937,067 Q537K possibly damaging Het
Trim30a G T 7: 104,411,188 C460* probably null Het
Trim35 T C 14: 66,307,873 Y298H probably damaging Het
Ugt3a1 T A 15: 9,306,393 H209Q probably benign Het
Ulk4 T C 9: 121,192,764 K627R probably damaging Het
Wnk1 T C 6: 119,951,911 T1319A possibly damaging Het
Wnt9b G A 11: 103,732,155 R141C probably damaging Het
Zfp735 A G 11: 73,689,785 M37V probably benign Het
Zmym1 A T 4: 127,050,835 N186K probably benign Het
Other mutations in Ptger4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Ptger4 APN 15 5243133 missense probably benign 0.00
IGL00848:Ptger4 APN 15 5235108 missense probably benign 0.16
IGL01309:Ptger4 APN 15 5242758 missense probably damaging 1.00
IGL02083:Ptger4 APN 15 5243174 missense probably benign 0.00
IGL03245:Ptger4 APN 15 5235107 missense probably damaging 1.00
R0369:Ptger4 UTSW 15 5243010 missense probably benign 0.06
R0427:Ptger4 UTSW 15 5242901 missense probably benign 0.25
R1399:Ptger4 UTSW 15 5234931 missense possibly damaging 0.81
R1778:Ptger4 UTSW 15 5235095 missense probably damaging 1.00
R1801:Ptger4 UTSW 15 5242800 missense possibly damaging 0.95
R2089:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2091:Ptger4 UTSW 15 5242845 missense possibly damaging 0.80
R2484:Ptger4 UTSW 15 5235173 missense probably benign 0.06
R2873:Ptger4 UTSW 15 5234805 missense probably benign 0.02
R4515:Ptger4 UTSW 15 5242379 missense probably damaging 1.00
R4655:Ptger4 UTSW 15 5243064 missense probably benign 0.06
R4860:Ptger4 UTSW 15 5242606 missense probably benign 0.02
R4860:Ptger4 UTSW 15 5242606 missense probably benign 0.02
R6429:Ptger4 UTSW 15 5242997 missense possibly damaging 0.76
R6960:Ptger4 UTSW 15 5234715 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCCACATACTAGAGTGTAAAAGG -3'
(R):5'- ACAGAACGGATCCAGACCTTG -3'

Sequencing Primer
(F):5'- ACTAGAGTGTAAAAGGTCGTCTC -3'
(R):5'- GTCACAGTTAATGAGTAGCTACCG -3'
Posted On2015-09-24