Mutagenetix > Incidental Mutation

Incidental Mutation 'R4572:Kalrn'

342227

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

041796-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.908) question?

Stock #

R4572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34392042 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 27 (F27L)

Ref Sequence

ENSEMBL: ENSMUSP00000076088 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]

AlphaFold

no structure available at present

PDB Structure

Solution structure of SH3 domain of mouse Kalirin-9a protein [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000076810
AA Change: F27L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: F27L

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000089655
AA Change: F45L

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: F45L

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114960
AA Change: F45L

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: F45L

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: F22L

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: F22L

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000151491
AA Change: F33L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: F33L

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,216,548	I747N	probably benign	Het
Adamtsl2	A	G	2: 27,083,256	Y97C	probably damaging	Het
Alox12e	A	G	11: 70,321,181		probably benign	Het
Alpk2	A	T	18: 65,281,004	S2014T	probably damaging	Het
Ankrd36	A	T	11: 5,689,340		probably null	Het
Apobec1	T	C	6: 122,581,397	D133G	probably damaging	Het
Arfgef1	A	T	1: 10,213,141	I181N	probably damaging	Het
C130060K24Rik	A	T	6: 65,454,991	M293L	probably benign	Het
Cilp2	A	G	8: 69,882,410	V646A	probably damaging	Het
Clasrp	A	G	7: 19,584,464		probably null	Het
Cnot2	T	C	10: 116,494,846	T423A	probably benign	Het
Crtap	T	C	9: 114,384,806	D227G	probably benign	Het
Cyp17a1	A	G	19: 46,670,551	F217S	probably damaging	Het
Ddx60	A	G	8: 61,987,421	M1036V	probably damaging	Het
Dnah11	A	T	12: 118,010,125	I2818N	probably benign	Het
Dok6	T	A	18: 89,473,947	I169F	possibly damaging	Het
Duox2	T	A	2: 122,281,726	R1326S	probably benign	Het
Epha10	A	G	4: 124,902,568	T357A	unknown	Het
Ephb2	A	C	4: 136,655,940	F942C	probably damaging	Het
Fscn3	T	A	6: 28,430,635		probably null	Het
Gabrb2	A	G	11: 42,593,917	N267S	possibly damaging	Het
Gabrr3	A	T	16: 59,461,638	Y452F	probably benign	Het
Gen1	A	G	12: 11,242,418	S457P	probably damaging	Het
Gm1993	C	T	X: 25,560,356	R77H	probably damaging	Het
Gm5592	G	A	7: 41,216,159		probably benign	Het
Hmbox1	A	G	14: 64,903,233		probably null	Het
Hus1	A	T	11: 9,007,617		probably null	Het
Ino80	G	A	2: 119,402,358	R1160W	probably damaging	Het
Kri1	A	T	9: 21,280,384	F187L	probably damaging	Het
Lekr1	A	T	3: 65,783,915		noncoding transcript	Het
Mapk15	T	C	15: 75,998,750		probably benign	Het
Mrgpre	G	A	7: 143,781,104	L221F	probably damaging	Het
Mrpl50	A	T	4: 49,514,399	S91T	possibly damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mup15	A	G	4: 61,438,217		probably null	Het
Ncapd3	A	G	9: 27,094,615	D1469G	probably damaging	Het
Nlrp9b	G	A	7: 20,026,681		probably null	Het
Npy6r	A	T	18: 44,275,917	Y135F	probably benign	Het
Olfr862	A	C	9: 19,883,979	C109G	probably benign	Het
Phf14	G	A	6: 12,006,824	R825Q	probably damaging	Het
Pigg	A	G	5: 108,332,885	M379V	probably benign	Het
Plppr3	T	A	10: 79,866,063	Q315L	probably benign	Het
Plxnd1	C	A	6: 115,955,756	C1921F	probably damaging	Het
Ptger4	A	C	15: 5,243,133	S2A	probably benign	Het
Rab4a	A	T	8: 123,834,060	D196V	probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rgs14	A	T	13: 55,380,062	N266I	probably damaging	Het
Serpina1c	A	T	12: 103,898,708		probably benign	Het
Sesn3	G	A	9: 14,321,220	R263H	probably benign	Het
Slfn1	A	T	11: 83,121,463	D135V	probably benign	Het
Spata17	T	C	1: 187,193,996	K46E	possibly damaging	Het
Srcin1	A	C	11: 97,534,934	D432E	probably damaging	Het
Stxbp5	T	C	10: 9,838,144	E217G	probably damaging	Het
Terf2ip	A	G	8: 112,012,017	D179G	probably damaging	Het
Tll1	A	G	8: 64,056,309	F556L	possibly damaging	Het
Tmed4	CTCTTTCT	CTCT	11: 6,274,461		probably null	Het
Trappc9	G	T	15: 72,937,067	Q537K	possibly damaging	Het
Trim30a	G	T	7: 104,411,188	C460*	probably null	Het
Trim35	T	C	14: 66,307,873	Y298H	probably damaging	Het
Ugt3a1	T	A	15: 9,306,393	H209Q	probably benign	Het
Ulk4	T	C	9: 121,192,764	K627R	probably damaging	Het
Wnk1	T	C	6: 119,951,911	T1319A	possibly damaging	Het
Wnt9b	G	A	11: 103,732,155	R141C	probably damaging	Het
Zfp735	A	G	11: 73,689,785	M37V	probably benign	Het
Zmym1	A	T	4: 127,050,835	N186K	probably benign	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34175722	splice site	probably benign
IGL01364:Kalrn	APN	16	34262629	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34235330	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34294161	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34198512	splice site	probably null
IGL02059:Kalrn	APN	16	34252341	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34220222	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34310527	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34332224	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34360846	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34513959	nonsense	probably null
IGL02696:Kalrn	APN	16	34220114	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34392050	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34220130	nonsense	probably null
IGL03188:Kalrn	APN	16	34314192	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34385297	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34314176	missense	probably damaging	0.99
breeze	UTSW	16	34013675	missense
ethereal	UTSW	16	33975435	utr 3 prime	probably benign
Feather	UTSW	16	34314209	missense	probably damaging	0.99
Hidden	UTSW	16	34027976	missense	probably damaging	1.00
Soulful	UTSW	16	34187484	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34031582	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34198514	splice site	probably benign
R0043:Kalrn	UTSW	16	34054906	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34357171	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33975619	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34031590	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34049936	intron	probably benign
R0183:Kalrn	UTSW	16	34171379	splice site	probably null
R0422:Kalrn	UTSW	16	34314273	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34054891	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33993670	splice site	probably benign
R0656:Kalrn	UTSW	16	34032467	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34116408	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34010581	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34035554	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34049919	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34385390	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34016498	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33975584	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33988803	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34212820	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33975754	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34174487	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34187471	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34314278	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34010548	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34360950	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34212873	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34294215	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34356961	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33975923	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34392093	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33977524	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33975738	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34028045	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34189736	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34252310	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34332143	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34332230	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34307724	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34009262	unclassified	probably benign
R2193:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34176262	splice site	probably null
R2404:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34310495	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34212272	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34357315	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34392030	splice site	probably null
R3788:Kalrn	UTSW	16	34220240	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34039889	nonsense	probably null
R3871:Kalrn	UTSW	16	34203856	splice site	probably null
R3934:Kalrn	UTSW	16	34310531	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34314209	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34235391	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33987208	missense	possibly damaging	0.46
R4583:Kalrn	UTSW	16	34235267	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34513926	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34028705	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34176391	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34203957	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34198487	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33989810	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34356969	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34514019	unclassified	probably benign
R4888:Kalrn	UTSW	16	34171330	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34357415	splice site	probably null
R5030:Kalrn	UTSW	16	33975742	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34314352	nonsense	probably null
R5117:Kalrn	UTSW	16	34033601	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34252341	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34262653	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34053622	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34175780	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34039934	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34014084	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34016579	missense	probably benign
R5716:Kalrn	UTSW	16	33987176	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33975820	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34212249	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33987091	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33975435	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34243833	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34357343	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34010580	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34360885	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33985191	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34212885	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34357111	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34053639	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34055071	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33975991	missense	probably benign
R6397:Kalrn	UTSW	16	33992985	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34332164	missense	possibly damaging	0.85
R6473:Kalrn	UTSW	16	34205302	missense	probably damaging	1.00
R6481:Kalrn	UTSW	16	34360984	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34182747	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34217923	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34027976	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33975703	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34220136	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34357048	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34217891	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34256227	missense	unknown
R7154:Kalrn	UTSW	16	34212157	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34163077	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34176422	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34175761	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34256233	missense	unknown
R7563:Kalrn	UTSW	16	34392094	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34314212	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34031582	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34187484	nonsense	probably null
R7867:Kalrn	UTSW	16	33989791	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33988847	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34028752	missense	probably benign
R8080:Kalrn	UTSW	16	33975668	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34055044	missense	probably benign
R8239:Kalrn	UTSW	16	34049783	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34035061	nonsense	probably null
R8294:Kalrn	UTSW	16	34033584	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34357100	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34360935	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34034514	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33982855	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34198460	missense	probably benign	0.05
R8878:Kalrn	UTSW	16	34205326	missense	probably damaging	1.00
R8880:Kalrn	UTSW	16	34217935	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33993655	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34227126	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34034484	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34361001	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34013675	missense
R9424:Kalrn	UTSW	16	33988818	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34095879	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33985230	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34034494	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34028827	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34212213	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34039933	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34035506	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCATGAAAGCCTAACTGC -3'
(R):5'- GAGAAGAAGGCTTTAACCCCATCAC -3'

Sequencing Primer
(F):5'- GAAAGCCTAACTGCTAATGTGTCTCC -3'
(R):5'- CATCACAATGGGGACTCTCC -3'

Posted On

2015-09-24