Incidental Mutation 'R0316:Trap1'
ID34223
Institutional Source Beutler Lab
Gene Symbol Trap1
Ensembl Gene ENSMUSG00000005981
Gene NameTNF receptor-associated protein 1
SynonymsHSP75, 2410002K23Rik
MMRRC Submission 038526-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0316 (G1)
Quality Score185
Status Not validated
Chromosome16
Chromosomal Location4039971-4077827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4045560 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 533 (F533L)
Ref Sequence ENSEMBL: ENSMUSP00000006137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006137]
Predicted Effect probably benign
Transcript: ENSMUST00000006137
AA Change: F533L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981
AA Change: F533L

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced body weight; liver and spleen hyperplasia; decreased chronic inflammation and tumor incidents; deregulated mitochondrial respiration; and increased oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,025,369 F276I probably damaging Het
Ado A G 10: 67,548,718 L19P possibly damaging Het
Ago2 T C 15: 73,130,876 H169R probably damaging Het
Asic1 G A 15: 99,671,938 A47T probably benign Het
Atg16l2 A T 7: 101,293,396 I364N probably damaging Het
C130050O18Rik G A 5: 139,414,558 R122Q probably damaging Het
Capn7 T A 14: 31,347,809 C197S probably benign Het
Casp16-ps T C 17: 23,552,092 D113G probably damaging Het
Cdh18 T A 15: 23,366,913 V235D probably damaging Het
Clca4a G T 3: 144,953,764 T777K probably damaging Het
Col17a1 A G 19: 47,685,533 probably null Het
Col5a3 C A 9: 20,775,325 D1335Y unknown Het
Cpxm1 T C 2: 130,393,171 E576G probably damaging Het
Dcbld2 T C 16: 58,433,445 S182P probably damaging Het
Dclk1 C T 3: 55,502,892 S616L probably damaging Het
Dgcr14 G A 16: 17,910,094 P103S probably benign Het
Dll4 C A 2: 119,331,153 D405E probably damaging Het
Dnah1 G A 14: 31,278,151 R2462C probably benign Het
Dnah3 A T 7: 119,965,659 Y2594N possibly damaging Het
Fam110a C A 2: 151,970,086 A255S probably benign Het
Fbn2 G A 18: 58,113,325 R502W probably damaging Het
Fgl2 A G 5: 21,375,523 S288G possibly damaging Het
Gm1527 T C 3: 28,915,774 S342P probably damaging Het
Gm19668 A T 10: 77,798,730 probably benign Het
Gm5901 A T 7: 105,377,315 T97S probably damaging Het
Greb1l A G 18: 10,547,420 Y1546C probably damaging Het
Impg1 A T 9: 80,342,065 S619T probably damaging Het
Itih2 C A 2: 10,105,246 Q565H possibly damaging Het
Kbtbd6 T A 14: 79,453,024 N386K probably benign Het
Lama3 T C 18: 12,519,877 M218T probably benign Het
Lipg T C 18: 74,960,941 S12G probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mex3d G T 10: 80,381,671 P571T probably damaging Het
Neb A C 2: 52,195,470 Y1538D possibly damaging Het
Nsd1 T C 13: 55,213,771 I184T probably damaging Het
Olfr1143 T C 2: 87,803,181 F264S probably damaging Het
Olfr1451 T A 19: 12,999,402 C139S probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pacs1 T C 19: 5,135,121 silent Het
Pdcd11 T C 19: 47,113,172 V932A probably damaging Het
Pkd2 A G 5: 104,477,166 D276G probably damaging Het
Pkia T A 3: 7,437,439 D25E probably damaging Het
Plxna2 A C 1: 194,644,150 S131R probably damaging Het
Prelid1 T C 13: 55,324,407 V132A possibly damaging Het
Psma3 T C 12: 70,983,389 Y59H probably benign Het
Ptchd3 A C 11: 121,842,090 E602A possibly damaging Het
Ptpro T C 6: 137,376,989 V121A possibly damaging Het
Ptprt A G 2: 161,607,319 L878P probably damaging Het
Pxn G A 5: 115,553,968 G370S probably damaging Het
Rcn2 G T 9: 56,042,169 A40S probably benign Het
Rnf215 A G 11: 4,139,760 N258D probably damaging Het
Rnpc3 T C 3: 113,629,973 T28A probably damaging Het
Rtel1 T A 2: 181,356,002 V1100E possibly damaging Het
Scn3a T A 2: 65,460,829 I1858F probably damaging Het
Slc9c1 G A 16: 45,580,232 R735Q possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Spata13 A G 14: 60,692,339 T449A probably benign Het
Svep1 A G 4: 58,072,737 W2191R probably damaging Het
Thbs1 G A 2: 118,117,574 R405H probably damaging Het
Tnn A G 1: 160,120,567 Y859H possibly damaging Het
Tonsl A G 15: 76,629,300 S1245P possibly damaging Het
Tpcn1 G A 5: 120,539,259 T661M probably damaging Het
Ttc23 T C 7: 67,679,073 probably null Het
Vax2 T C 6: 83,711,444 S50P possibly damaging Het
Vmn1r5 A C 6: 56,985,799 E153A probably benign Het
Vmn2r14 G T 5: 109,218,896 P486Q probably benign Het
Vmn2r96 T A 17: 18,582,565 F246I probably damaging Het
Zc3h10 C A 10: 128,544,755 E244D probably damaging Het
Zdhhc18 T A 4: 133,613,655 K265* probably null Het
Other mutations in Trap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Trap1 APN 16 4043978 nonsense probably null
IGL03087:Trap1 APN 16 4044701 splice site probably null
E0354:Trap1 UTSW 16 4065288 missense probably benign 0.01
R0034:Trap1 UTSW 16 4069030 splice site probably benign
R0034:Trap1 UTSW 16 4069030 splice site probably benign
R0336:Trap1 UTSW 16 4044626 missense probably damaging 0.99
R0614:Trap1 UTSW 16 4060751 splice site probably benign
R2069:Trap1 UTSW 16 4068336 missense probably benign
R2089:Trap1 UTSW 16 4046039 nonsense probably null
R2091:Trap1 UTSW 16 4046039 nonsense probably null
R2091:Trap1 UTSW 16 4046039 nonsense probably null
R2148:Trap1 UTSW 16 4060760 missense probably damaging 0.97
R2419:Trap1 UTSW 16 4068330 missense probably benign 0.23
R3853:Trap1 UTSW 16 4054822 missense possibly damaging 0.69
R4926:Trap1 UTSW 16 4045488 missense probably benign 0.27
R5120:Trap1 UTSW 16 4044088 missense probably damaging 1.00
R5261:Trap1 UTSW 16 4056422 missense probably damaging 1.00
R5434:Trap1 UTSW 16 4044665 missense probably benign 0.00
R6194:Trap1 UTSW 16 4054800 missense possibly damaging 0.94
R6284:Trap1 UTSW 16 4060809 missense probably benign 0.07
R6415:Trap1 UTSW 16 4043992 missense possibly damaging 0.92
R7132:Trap1 UTSW 16 4055829 missense probably benign 0.17
R7167:Trap1 UTSW 16 4052928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGTGAGGAATGCAATGCACTC -3'
(R):5'- GGCACCCGCAACATCTATTACCTG -3'

Sequencing Primer
(F):5'- GTGACAGTCTCCTGCCCAAC -3'
(R):5'- GCTGGGCCAAGAATGTATCTTAC -3'
Posted On2013-05-09