Incidental Mutation 'R4573:Vmn2r5'
ID 342252
Institutional Source Beutler Lab
Gene Symbol Vmn2r5
Ensembl Gene ENSMUSG00000068999
Gene Name vomeronasal 2, receptor 5
Synonyms EG667060
MMRRC Submission 041598-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock # R4573 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 64490821-64509735 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 64503918 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 410 (D410N)
Ref Sequence ENSEMBL: ENSMUSP00000135592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170270] [ENSMUST00000177184]
AlphaFold K7N788
Predicted Effect probably damaging
Transcript: ENSMUST00000170270
AA Change: D323N

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131925
Gene: ENSMUSG00000068999
AA Change: D323N

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 9.9e-78 PFAM
Pfam:NCD3G 458 511 8.5e-18 PFAM
Pfam:7tm_3 542 779 2.3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177184
AA Change: D410N

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135592
Gene: ENSMUSG00000068999
AA Change: D410N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 86 503 1.8e-80 PFAM
Pfam:NCD3G 545 598 1e-14 PFAM
Pfam:7tm_3 631 865 1.4e-45 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,345,986 E212G probably damaging Het
Adam1b A C 5: 121,500,793 S730A probably benign Het
Akr1b10 T C 6: 34,392,129 V153A probably damaging Het
Ap1m2 T C 9: 21,305,758 Y94C probably damaging Het
Arhgef33 T C 17: 80,365,282 S320P probably damaging Het
Arsg T C 11: 109,517,282 S87P probably damaging Het
Asic3 A G 5: 24,417,192 Y458C probably damaging Het
Aspm G T 1: 139,479,507 W2044L probably damaging Het
Atad2b T C 12: 4,954,663 probably null Het
Atp1a2 T C 1: 172,278,637 I869M possibly damaging Het
Bpifb2 C T 2: 153,889,492 L263F probably damaging Het
C1s2 T C 6: 124,628,243 probably null Het
Carf G T 1: 60,148,112 A590S probably benign Het
Cbarp G T 10: 80,131,411 D658E probably damaging Het
Cd1d2 A G 3: 86,987,554 I78V probably benign Het
Cdc42bpb A T 12: 111,323,141 M418K probably benign Het
Cdhr3 A T 12: 33,068,153 probably null Het
Cep290 A G 10: 100,518,850 K932R probably benign Het
Ces1d A C 8: 93,181,534 N310K probably benign Het
Chka A G 19: 3,885,960 K240R probably damaging Het
Cltb C T 13: 54,598,761 R64H probably damaging Het
Cyp4f37 A G 17: 32,629,087 E193G probably benign Het
Dhrs9 C A 2: 69,397,641 H200N probably benign Het
Dnah6 T A 6: 73,086,181 N2698I probably damaging Het
Dnah8 T C 17: 30,700,406 S1118P probably benign Het
Dyrk1a A G 16: 94,692,023 Y705C possibly damaging Het
Elmod1 T C 9: 53,925,972 N183S probably damaging Het
Fam129a T C 1: 151,703,766 V412A possibly damaging Het
Fer1l6 G A 15: 58,626,280 probably null Het
Fsip2 A T 2: 82,986,166 Y4081F possibly damaging Het
Gm38394 A G 1: 133,659,389 I70T probably benign Het
Gsr A G 8: 33,693,853 D381G probably benign Het
Gucy1a1 A G 3: 82,108,922 L253S possibly damaging Het
Herc3 C A 6: 58,894,113 T69K possibly damaging Het
Hoxb13 A G 11: 96,194,951 Y170C probably damaging Het
Hsd3b5 T C 3: 98,619,648 M161V probably benign Het
Lrp6 G A 6: 134,470,730 R985* probably null Het
March5 T A 19: 37,220,394 I154K probably damaging Het
Mcemp1 A G 8: 3,665,835 probably null Het
Mrpl2 G T 17: 46,649,041 C212F possibly damaging Het
Mterf1a G A 5: 3,891,119 R250W possibly damaging Het
Mthfd1 A G 12: 76,294,138 probably null Het
Mul1 T C 4: 138,436,349 F19L probably benign Het
Mycbp2 G T 14: 103,346,297 A74E probably benign Het
Myo5a A T 9: 75,201,297 probably null Het
Ncor2 A T 5: 125,055,825 S33T probably damaging Het
Ninj1 A G 13: 49,194,987 N191S probably damaging Het
Nrap T C 19: 56,342,338 probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr353 T C 2: 36,890,190 I219M probably damaging Het
Olfr50 T A 2: 36,793,479 M81K probably damaging Het
Osbpl5 C A 7: 143,694,316 V671L probably benign Het
Paics T C 5: 76,956,603 L25S probably benign Het
Pcmtd1 A G 1: 7,120,367 E20G probably damaging Het
Pgbd5 G A 8: 124,376,227 Q228* probably null Het
Pnpla7 T C 2: 25,050,873 V1079A probably damaging Het
Pou2f1 G A 1: 165,913,261 T113I probably benign Het
Ppp1r14c A G 10: 3,463,416 I150V possibly damaging Het
Ppp1r2 A G 16: 31,260,637 Y115H possibly damaging Het
Ptchd4 T C 17: 42,502,777 V523A probably benign Het
Rabep1 G C 11: 70,917,751 S468T probably damaging Het
Rgs6 T A 12: 83,066,015 W200R probably damaging Het
Ryr3 C T 2: 112,755,174 probably null Het
Scamp2 A T 9: 57,577,194 D20V probably damaging Het
Sec24d G A 3: 123,358,870 V844M probably damaging Het
Sept10 T A 10: 59,192,329 N57Y probably damaging Het
Sis T C 3: 72,928,237 K931E possibly damaging Het
Slamf7 T C 1: 171,636,366 T258A probably benign Het
Slc15a1 A G 14: 121,487,029 S144P probably damaging Het
Slc6a7 A T 18: 61,002,181 V425E probably benign Het
Syt7 C T 19: 10,439,212 R253* probably null Het
Tm4sf1 A T 3: 57,294,785 C2S possibly damaging Het
Trio CCTTCTTCTTCT CCTTCTTCT 15: 27,772,998 probably benign Het
Trpm3 C T 19: 22,902,142 H594Y probably damaging Het
Tshz1 A T 18: 84,015,082 N400K probably damaging Het
Vat1 A T 11: 101,460,615 M300K probably benign Het
Vmn1r70 C A 7: 10,633,629 probably null Het
Yap1 T C 9: 7,934,681 D428G probably damaging Het
Zfp157 A G 5: 138,456,929 Y463C probably damaging Het
Other mutations in Vmn2r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Vmn2r5 APN 3 64491413 missense possibly damaging 0.67
IGL01139:Vmn2r5 APN 3 64491405 missense probably benign 0.28
IGL03293:Vmn2r5 APN 3 64491326 missense probably benign 0.01
PIT4581001:Vmn2r5 UTSW 3 64503927 nonsense probably null
R0063:Vmn2r5 UTSW 3 64503800 missense probably benign 0.01
R0142:Vmn2r5 UTSW 3 64492588 missense probably damaging 1.00
R0193:Vmn2r5 UTSW 3 64491530 missense possibly damaging 0.91
R0219:Vmn2r5 UTSW 3 64504313 missense probably damaging 0.99
R0313:Vmn2r5 UTSW 3 64503827 missense probably benign
R0620:Vmn2r5 UTSW 3 64503814 nonsense probably null
R0726:Vmn2r5 UTSW 3 64503765 missense probably benign 0.01
R1073:Vmn2r5 UTSW 3 64491305 nonsense probably null
R1549:Vmn2r5 UTSW 3 64504000 missense probably damaging 1.00
R1581:Vmn2r5 UTSW 3 64491219 missense probably damaging 1.00
R1624:Vmn2r5 UTSW 3 64509695 missense probably benign 0.19
R1973:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1974:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1975:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1977:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R2189:Vmn2r5 UTSW 3 64509593 missense probably benign 0.27
R2484:Vmn2r5 UTSW 3 64503971 missense possibly damaging 0.94
R5243:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5384:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5385:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5587:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5588:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5589:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5590:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5739:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R6113:Vmn2r5 UTSW 3 64491399 missense probably benign 0.03
R6739:Vmn2r5 UTSW 3 64491216 missense probably damaging 0.97
R7106:Vmn2r5 UTSW 3 64491683 missense probably benign 0.05
R7304:Vmn2r5 UTSW 3 64504250 missense probably damaging 0.97
R7402:Vmn2r5 UTSW 3 64495755 missense probably benign 0.05
R7477:Vmn2r5 UTSW 3 64491639 missense probably damaging 1.00
R7571:Vmn2r5 UTSW 3 64504404 missense probably damaging 1.00
R7678:Vmn2r5 UTSW 3 64509522 missense probably benign
R7874:Vmn2r5 UTSW 3 64491032 missense probably damaging 1.00
R8110:Vmn2r5 UTSW 3 64491288 missense probably benign 0.00
R8223:Vmn2r5 UTSW 3 64491305 nonsense probably null
R8767:Vmn2r5 UTSW 3 64507682 missense possibly damaging 0.79
R8896:Vmn2r5 UTSW 3 64503782 missense probably benign 0.00
R8948:Vmn2r5 UTSW 3 64491101 missense probably damaging 1.00
R8950:Vmn2r5 UTSW 3 64491101 missense probably damaging 1.00
R8962:Vmn2r5 UTSW 3 64491143 missense probably damaging 1.00
R9012:Vmn2r5 UTSW 3 64504494 missense probably damaging 1.00
R9109:Vmn2r5 UTSW 3 64503990 missense possibly damaging 0.58
R9126:Vmn2r5 UTSW 3 64491738 missense probably benign 0.13
R9192:Vmn2r5 UTSW 3 64491517 nonsense probably null
R9221:Vmn2r5 UTSW 3 64504300 nonsense probably null
R9375:Vmn2r5 UTSW 3 64503895 missense probably damaging 1.00
R9529:Vmn2r5 UTSW 3 64492597 missense probably benign 0.06
Z1088:Vmn2r5 UTSW 3 64509542 missense probably benign 0.02
Z1177:Vmn2r5 UTSW 3 64491051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCAAACCTTGGTTTTACC -3'
(R):5'- CTAGCAAGGATCCAAATGATGTC -3'

Sequencing Primer
(F):5'- GGTCAAATAACGTACCTCTTTGGGC -3'
(R):5'- GCAAGGATCCAAATGATGTCTTGACC -3'
Posted On 2015-09-24