Mutagenetix > Incidental Mutation

Incidental Mutation 'R4573:Gucy1a1'

342254

Institutional Source

Beutler Lab

Gene Symbol

Gucy1a1

Ensembl Gene

ENSMUSG00000033910

Gene Name

guanylate cyclase 1, soluble, alpha 1

Synonyms

sGC-alpha1, alpha 1 sGC, 1200016O07Rik

MMRRC Submission

041598-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R4573 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

82092427-82145789 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 82108922 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 253 (L253S)

Ref Sequence

ENSEMBL: ENSMUSP00000142138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]

AlphaFold

Q9ERL9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048976
AA Change: L253S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910
AA Change: L253S

Domain	Start	End	E-Value	Type
Pfam:HNOB	85	235	2.5e-8	PFAM
PDB:4GJ4\|D	277	403	1e-18	PDB
CYCc	445	636	4.71e-103	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183464

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191942

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193924
AA Change: L253S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910
AA Change: L253S

Domain	Start	End	E-Value	Type
Pfam:HNOB	73	237	1.6e-7	PFAM
PDB:4GJ4\|D	277	403	1e-18	PDB
CYCc	445	636	4.71e-103	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam15	T	C	3: 89,345,986	E212G	probably damaging	Het
Adam1b	A	C	5: 121,500,793	S730A	probably benign	Het
Akr1b10	T	C	6: 34,392,129	V153A	probably damaging	Het
Ap1m2	T	C	9: 21,305,758	Y94C	probably damaging	Het
Arhgef33	T	C	17: 80,365,282	S320P	probably damaging	Het
Arsg	T	C	11: 109,517,282	S87P	probably damaging	Het
Asic3	A	G	5: 24,417,192	Y458C	probably damaging	Het
Aspm	G	T	1: 139,479,507	W2044L	probably damaging	Het
Atad2b	T	C	12: 4,954,663		probably null	Het
Atp1a2	T	C	1: 172,278,637	I869M	possibly damaging	Het
Bpifb2	C	T	2: 153,889,492	L263F	probably damaging	Het
C1s2	T	C	6: 124,628,243		probably null	Het
Carf	G	T	1: 60,148,112	A590S	probably benign	Het
Cbarp	G	T	10: 80,131,411	D658E	probably damaging	Het
Cd1d2	A	G	3: 86,987,554	I78V	probably benign	Het
Cdc42bpb	A	T	12: 111,323,141	M418K	probably benign	Het
Cdhr3	A	T	12: 33,068,153		probably null	Het
Cep290	A	G	10: 100,518,850	K932R	probably benign	Het
Ces1d	A	C	8: 93,181,534	N310K	probably benign	Het
Chka	A	G	19: 3,885,960	K240R	probably damaging	Het
Cltb	C	T	13: 54,598,761	R64H	probably damaging	Het
Cyp4f37	A	G	17: 32,629,087	E193G	probably benign	Het
Dhrs9	C	A	2: 69,397,641	H200N	probably benign	Het
Dnah6	T	A	6: 73,086,181	N2698I	probably damaging	Het
Dnah8	T	C	17: 30,700,406	S1118P	probably benign	Het
Dyrk1a	A	G	16: 94,692,023	Y705C	possibly damaging	Het
Elmod1	T	C	9: 53,925,972	N183S	probably damaging	Het
Fam129a	T	C	1: 151,703,766	V412A	possibly damaging	Het
Fer1l6	G	A	15: 58,626,280		probably null	Het
Fsip2	A	T	2: 82,986,166	Y4081F	possibly damaging	Het
Gm38394	A	G	1: 133,659,389	I70T	probably benign	Het
Gsr	A	G	8: 33,693,853	D381G	probably benign	Het
Herc3	C	A	6: 58,894,113	T69K	possibly damaging	Het
Hoxb13	A	G	11: 96,194,951	Y170C	probably damaging	Het
Hsd3b5	T	C	3: 98,619,648	M161V	probably benign	Het
Lrp6	G	A	6: 134,470,730	R985*	probably null	Het
March5	T	A	19: 37,220,394	I154K	probably damaging	Het
Mcemp1	A	G	8: 3,665,835		probably null	Het
Mrpl2	G	T	17: 46,649,041	C212F	possibly damaging	Het
Mterf1a	G	A	5: 3,891,119	R250W	possibly damaging	Het
Mthfd1	A	G	12: 76,294,138		probably null	Het
Mul1	T	C	4: 138,436,349	F19L	probably benign	Het
Mycbp2	G	T	14: 103,346,297	A74E	probably benign	Het
Myo5a	A	T	9: 75,201,297		probably null	Het
Ncor2	A	T	5: 125,055,825	S33T	probably damaging	Het
Ninj1	A	G	13: 49,194,987	N191S	probably damaging	Het
Nrap	T	C	19: 56,342,338		probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr353	T	C	2: 36,890,190	I219M	probably damaging	Het
Olfr50	T	A	2: 36,793,479	M81K	probably damaging	Het
Osbpl5	C	A	7: 143,694,316	V671L	probably benign	Het
Paics	T	C	5: 76,956,603	L25S	probably benign	Het
Pcmtd1	A	G	1: 7,120,367	E20G	probably damaging	Het
Pgbd5	G	A	8: 124,376,227	Q228*	probably null	Het
Pnpla7	T	C	2: 25,050,873	V1079A	probably damaging	Het
Pou2f1	G	A	1: 165,913,261	T113I	probably benign	Het
Ppp1r14c	A	G	10: 3,463,416	I150V	possibly damaging	Het
Ppp1r2	A	G	16: 31,260,637	Y115H	possibly damaging	Het
Ptchd4	T	C	17: 42,502,777	V523A	probably benign	Het
Rabep1	G	C	11: 70,917,751	S468T	probably damaging	Het
Rgs6	T	A	12: 83,066,015	W200R	probably damaging	Het
Ryr3	C	T	2: 112,755,174		probably null	Het
Scamp2	A	T	9: 57,577,194	D20V	probably damaging	Het
Sec24d	G	A	3: 123,358,870	V844M	probably damaging	Het
Sept10	T	A	10: 59,192,329	N57Y	probably damaging	Het
Sis	T	C	3: 72,928,237	K931E	possibly damaging	Het
Slamf7	T	C	1: 171,636,366	T258A	probably benign	Het
Slc15a1	A	G	14: 121,487,029	S144P	probably damaging	Het
Slc6a7	A	T	18: 61,002,181	V425E	probably benign	Het
Syt7	C	T	19: 10,439,212	R253*	probably null	Het
Tm4sf1	A	T	3: 57,294,785	C2S	possibly damaging	Het
Trio	CCTTCTTCTTCT	CCTTCTTCT	15: 27,772,998		probably benign	Het
Trpm3	C	T	19: 22,902,142	H594Y	probably damaging	Het
Tshz1	A	T	18: 84,015,082	N400K	probably damaging	Het
Vat1	A	T	11: 101,460,615	M300K	probably benign	Het
Vmn1r70	C	A	7: 10,633,629		probably null	Het
Vmn2r5	C	T	3: 64,503,918	D410N	probably damaging	Het
Yap1	T	C	9: 7,934,681	D428G	probably damaging	Het
Zfp157	A	G	5: 138,456,929	Y463C	probably damaging	Het

Other mutations in Gucy1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00951:Gucy1a1	APN	3	82111191	missense	probably benign	0.00
IGL01626:Gucy1a1	APN	3	82108619	missense	probably damaging	1.00
IGL01662:Gucy1a1	APN	3	82109253	missense	possibly damaging	0.63
IGL02480:Gucy1a1	APN	3	82097733	missense	probably damaging	1.00
IGL02902:Gucy1a1	APN	3	82118917	missense	possibly damaging	0.87
IGL03022:Gucy1a1	APN	3	82109097	missense	probably benign	0.30
IGL03056:Gucy1a1	APN	3	82113287	missense	probably benign	0.00
IGL03089:Gucy1a1	APN	3	82097681	missense	probably damaging	1.00
IGL03226:Gucy1a1	APN	3	82119024	missense	probably benign	0.00
IGL03377:Gucy1a1	APN	3	82106015	missense	probably damaging	1.00
R0245:Gucy1a1	UTSW	3	82108787	missense	possibly damaging	0.67
R0762:Gucy1a1	UTSW	3	82094896	missense	unknown
R0907:Gucy1a1	UTSW	3	82111191	missense	probably benign	0.00
R1242:Gucy1a1	UTSW	3	82105953	splice site	probably null
R1625:Gucy1a1	UTSW	3	82102055	missense	probably benign	0.02
R1671:Gucy1a1	UTSW	3	82106222	missense	probably damaging	1.00
R2056:Gucy1a1	UTSW	3	82109285	missense	possibly damaging	0.89
R2094:Gucy1a1	UTSW	3	82113332	missense	probably benign
R2140:Gucy1a1	UTSW	3	82118886	splice site	probably null
R2154:Gucy1a1	UTSW	3	82111151	critical splice donor site	probably null
R3418:Gucy1a1	UTSW	3	82106133	missense	probably damaging	1.00
R3419:Gucy1a1	UTSW	3	82106133	missense	probably damaging	1.00
R4290:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4291:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4292:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4294:Gucy1a1	UTSW	3	82094759	missense	possibly damaging	0.95
R4629:Gucy1a1	UTSW	3	82097624	missense	probably damaging	1.00
R4755:Gucy1a1	UTSW	3	82094795	missense	probably benign	0.40
R4865:Gucy1a1	UTSW	3	82119162	utr 5 prime	probably benign
R5528:Gucy1a1	UTSW	3	82109073	missense	probably damaging	1.00
R5933:Gucy1a1	UTSW	3	82094807	missense	probably damaging	0.96
R6278:Gucy1a1	UTSW	3	82097634	missense	probably damaging	1.00
R6385:Gucy1a1	UTSW	3	82109006	missense	probably benign
R7011:Gucy1a1	UTSW	3	82109115	missense	probably damaging	1.00
R7361:Gucy1a1	UTSW	3	82097720	missense	probably damaging	1.00
R7648:Gucy1a1	UTSW	3	82108707	missense	possibly damaging	0.63
R7709:Gucy1a1	UTSW	3	82094789	missense	unknown
R7770:Gucy1a1	UTSW	3	82108805	missense	possibly damaging	0.95
R8443:Gucy1a1	UTSW	3	82097693	missense	probably damaging	1.00
R8531:Gucy1a1	UTSW	3	82111161	missense	probably benign
R8872:Gucy1a1	UTSW	3	82108742	missense	probably damaging	0.99
R9055:Gucy1a1	UTSW	3	82109126	missense	possibly damaging	0.73
R9168:Gucy1a1	UTSW	3	82102046	missense	probably damaging	0.97
R9231:Gucy1a1	UTSW	3	82106001	missense	probably damaging	1.00
R9316:Gucy1a1	UTSW	3	82108943	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- CTTCAAAGTTGGGCTTCCCTTG -3'
(R):5'- TCCATCTTATGCCTGGACAAG -3'

Sequencing Primer
(F):5'- GGAAGTCCCTCTTGTTCACCAG -3'
(R):5'- CAAGGACCAGGACTTTCTAAATG -3'

Posted On

2015-09-24