Incidental Mutation 'R4573:Vmn1r70'
ID 342269
Institutional Source Beutler Lab
Gene Symbol Vmn1r70
Ensembl Gene ENSMUSG00000045340
Gene Name vomeronasal 1 receptor 70
Synonyms V1rl1
MMRRC Submission 041598-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R4573 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 10367514-10368410 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 10367556 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055847] [ENSMUST00000226255] [ENSMUST00000228090]
AlphaFold Q8R254
Predicted Effect probably damaging
Transcript: ENSMUST00000055847
AA Change: Q15K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054445
Gene: ENSMUSG00000045340
AA Change: Q15K

DomainStartEndE-ValueType
Pfam:TAS2R 1 292 2.6e-9 PFAM
Pfam:V1R 33 295 3.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226182
Predicted Effect probably damaging
Transcript: ENSMUST00000226255
AA Change: Q15K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably null
Transcript: ENSMUST00000228090
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam15 T C 3: 89,253,293 (GRCm39) E212G probably damaging Het
Adam1b A C 5: 121,638,856 (GRCm39) S730A probably benign Het
Akr1b10 T C 6: 34,369,064 (GRCm39) V153A probably damaging Het
Ap1m2 T C 9: 21,217,054 (GRCm39) Y94C probably damaging Het
Arhgef33 T C 17: 80,672,711 (GRCm39) S320P probably damaging Het
Arsg T C 11: 109,408,108 (GRCm39) S87P probably damaging Het
Asic3 A G 5: 24,622,190 (GRCm39) Y458C probably damaging Het
Aspm G T 1: 139,407,245 (GRCm39) W2044L probably damaging Het
Atad2b T C 12: 5,004,663 (GRCm39) probably null Het
Atp1a2 T C 1: 172,106,204 (GRCm39) I869M possibly damaging Het
Bpifb2 C T 2: 153,731,412 (GRCm39) L263F probably damaging Het
C1s2 T C 6: 124,605,202 (GRCm39) probably null Het
Carf G T 1: 60,187,271 (GRCm39) A590S probably benign Het
Cbarp G T 10: 79,967,245 (GRCm39) D658E probably damaging Het
Cd1d2 A G 3: 86,894,861 (GRCm39) I78V probably benign Het
Cdc42bpb A T 12: 111,289,575 (GRCm39) M418K probably benign Het
Cdhr3 A T 12: 33,118,152 (GRCm39) probably null Het
Cep290 A G 10: 100,354,712 (GRCm39) K932R probably benign Het
Ces1d A C 8: 93,908,162 (GRCm39) N310K probably benign Het
Chka A G 19: 3,935,960 (GRCm39) K240R probably damaging Het
Cltb C T 13: 54,746,574 (GRCm39) R64H probably damaging Het
Cyp4f37 A G 17: 32,848,061 (GRCm39) E193G probably benign Het
Dhrs9 C A 2: 69,227,985 (GRCm39) H200N probably benign Het
Dnah6 T A 6: 73,063,164 (GRCm39) N2698I probably damaging Het
Dnah8 T C 17: 30,919,380 (GRCm39) S1118P probably benign Het
Dyrk1a A G 16: 94,492,882 (GRCm39) Y705C possibly damaging Het
Elmod1 T C 9: 53,833,256 (GRCm39) N183S probably damaging Het
Fer1l6 G A 15: 58,498,129 (GRCm39) probably null Het
Fsip2 A T 2: 82,816,510 (GRCm39) Y4081F possibly damaging Het
Gsr A G 8: 34,183,881 (GRCm39) D381G probably benign Het
Gucy1a1 A G 3: 82,016,229 (GRCm39) L253S possibly damaging Het
Herc3 C A 6: 58,871,098 (GRCm39) T69K possibly damaging Het
Hoxb13 A G 11: 96,085,777 (GRCm39) Y170C probably damaging Het
Hsd3b5 T C 3: 98,526,964 (GRCm39) M161V probably benign Het
Lrp6 G A 6: 134,447,693 (GRCm39) R985* probably null Het
Marchf5 T A 19: 37,197,793 (GRCm39) I154K probably damaging Het
Mcemp1 A G 8: 3,715,835 (GRCm39) probably null Het
Mrpl2 G T 17: 46,959,967 (GRCm39) C212F possibly damaging Het
Mterf1a G A 5: 3,941,119 (GRCm39) R250W possibly damaging Het
Mthfd1 A G 12: 76,340,912 (GRCm39) probably null Het
Mul1 T C 4: 138,163,660 (GRCm39) F19L probably benign Het
Mycbp2 G T 14: 103,583,733 (GRCm39) A74E probably benign Het
Myo5a A T 9: 75,108,579 (GRCm39) probably null Het
Ncor2 A T 5: 125,132,889 (GRCm39) S33T probably damaging Het
Niban1 T C 1: 151,579,517 (GRCm39) V412A possibly damaging Het
Ninj1 A G 13: 49,348,463 (GRCm39) N191S probably damaging Het
Nrap T C 19: 56,330,770 (GRCm39) probably null Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or1j21 T A 2: 36,683,491 (GRCm39) M81K probably damaging Het
Or1n1b T C 2: 36,780,202 (GRCm39) I219M probably damaging Het
Osbpl5 C A 7: 143,248,053 (GRCm39) V671L probably benign Het
Paics T C 5: 77,104,450 (GRCm39) L25S probably benign Het
Pcmtd1 A G 1: 7,190,591 (GRCm39) E20G probably damaging Het
Pgbd5 G A 8: 125,102,966 (GRCm39) Q228* probably null Het
Pnpla7 T C 2: 24,940,885 (GRCm39) V1079A probably damaging Het
Pou2f1 G A 1: 165,740,830 (GRCm39) T113I probably benign Het
Ppp1r14c A G 10: 3,413,416 (GRCm39) I150V possibly damaging Het
Ppp1r2 A G 16: 31,079,455 (GRCm39) Y115H possibly damaging Het
Ptchd4 T C 17: 42,813,668 (GRCm39) V523A probably benign Het
Rabep1 G C 11: 70,808,577 (GRCm39) S468T probably damaging Het
Rgs6 T A 12: 83,112,789 (GRCm39) W200R probably damaging Het
Ryr3 C T 2: 112,585,519 (GRCm39) probably null Het
Scamp2 A T 9: 57,484,477 (GRCm39) D20V probably damaging Het
Sec24d G A 3: 123,152,519 (GRCm39) V844M probably damaging Het
Septin10 T A 10: 59,028,151 (GRCm39) N57Y probably damaging Het
Sis T C 3: 72,835,570 (GRCm39) K931E possibly damaging Het
Slamf7 T C 1: 171,463,934 (GRCm39) T258A probably benign Het
Slc15a1 A G 14: 121,724,441 (GRCm39) S144P probably damaging Het
Slc6a7 A T 18: 61,135,253 (GRCm39) V425E probably benign Het
Syt7 C T 19: 10,416,576 (GRCm39) R253* probably null Het
Tm4sf1 A T 3: 57,202,206 (GRCm39) C2S possibly damaging Het
Trio CCTTCTTCTTCT CCTTCTTCT 15: 27,773,084 (GRCm39) probably benign Het
Trpm3 C T 19: 22,879,506 (GRCm39) H594Y probably damaging Het
Tshz1 A T 18: 84,033,207 (GRCm39) N400K probably damaging Het
Vat1 A T 11: 101,351,441 (GRCm39) M300K probably benign Het
Vmn2r5 C T 3: 64,411,339 (GRCm39) D410N probably damaging Het
Yap1 T C 9: 7,934,682 (GRCm39) D428G probably damaging Het
Zbed6 A G 1: 133,587,127 (GRCm39) I70T probably benign Het
Zfp157 A G 5: 138,455,191 (GRCm39) Y463C probably damaging Het
Other mutations in Vmn1r70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03092:Vmn1r70 APN 7 10,368,186 (GRCm39) missense probably benign 0.23
IGL03250:Vmn1r70 APN 7 10,368,208 (GRCm39) missense probably damaging 1.00
R0375:Vmn1r70 UTSW 7 10,367,987 (GRCm39) missense probably damaging 1.00
R0482:Vmn1r70 UTSW 7 10,368,204 (GRCm39) missense probably damaging 1.00
R0497:Vmn1r70 UTSW 7 10,367,953 (GRCm39) missense probably benign 0.19
R1964:Vmn1r70 UTSW 7 10,367,737 (GRCm39) missense possibly damaging 0.88
R2067:Vmn1r70 UTSW 7 10,368,264 (GRCm39) missense possibly damaging 0.61
R3807:Vmn1r70 UTSW 7 10,367,715 (GRCm39) missense probably benign 0.01
R5070:Vmn1r70 UTSW 7 10,368,325 (GRCm39) missense probably benign 0.04
R5442:Vmn1r70 UTSW 7 10,367,877 (GRCm39) missense possibly damaging 0.69
R5558:Vmn1r70 UTSW 7 10,368,402 (GRCm39) missense probably benign 0.01
R6036:Vmn1r70 UTSW 7 10,367,830 (GRCm39) missense probably damaging 1.00
R6036:Vmn1r70 UTSW 7 10,367,830 (GRCm39) missense probably damaging 1.00
R6189:Vmn1r70 UTSW 7 10,367,598 (GRCm39) missense probably benign 0.04
R6976:Vmn1r70 UTSW 7 10,367,971 (GRCm39) missense probably benign 0.02
R7571:Vmn1r70 UTSW 7 10,367,871 (GRCm39) missense probably benign 0.00
R9236:Vmn1r70 UTSW 7 10,368,016 (GRCm39) missense probably damaging 1.00
R9568:Vmn1r70 UTSW 7 10,368,292 (GRCm39) missense probably benign 0.03
R9673:Vmn1r70 UTSW 7 10,368,364 (GRCm39) missense probably damaging 1.00
X0020:Vmn1r70 UTSW 7 10,367,517 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACTGACGTTAATATTCCCAC -3'
(R):5'- GACCAAATGCAGTCATTGTCTG -3'

Sequencing Primer
(F):5'- ACTGACGTTAATATTCCCACATAAAC -3'
(R):5'- CTGAGGGATTCCTTTGCAGAGAAC -3'
Posted On 2015-09-24